glenys
Uploaded by
40 SLIDES
1999 VIEWS
670LIKES

Research Proposal

DESCRIPTION

Research Proposal. Libo Cao Ph.D., Analytical (Dr. Peter de B. Harrington) Ohio University Department of Chemistry and Biochemistry Athens, OH 45701-2979. Ohio University Center for Intelligent Chemical Instrumentation.

1 / 40

Download Presentation

Research Proposal

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Research Proposal Libo Cao Ph.D., Analytical (Dr. Peter de B. Harrington) Ohio University Department of Chemistry and Biochemistry Athens, OH 45701-2979 Ohio University Center for Intelligent Chemical Instrumentation

  2. I. Introduction Molecular Beacon (MB) Single-stranded oligonucleotide probes with a hairpin structure that can identify the mutations in the human genome caused by DNA hybridization. Principle of Operation of MBs Ohio University Center for Intelligent Chemical Instrumentation

  3. Advantages Over Other DNA Probes • Extremely high selectivity with single base pair mismatch identification capability • The excellent capability of studying biological process in real time and in vivo, and avoiding the inconvenience caused by using DNA intercalation reagents or by labeling the target molecules or using competitive assays Ohio University Center for Intelligent Chemical Instrumentation

  4. What MBs can do? • Detection of single-nucleotide variations • Single-base mismatch • DNA sequencing • DNA biosensor based on MBs • Sensitive monitoring of the polymerase chain reaction • Real-time detection of DNA-RNA hybridization in living cells Ohio University Center for Intelligent Chemical Instrumentation

  5. Structure of A, T, C, G Ohio University Center for Intelligent Chemical Instrumentation

  6. Label Dyes with the Biomolecular 1,3-dicycolhexylcarbodiimide Dimethyl formamide Carboxylic group N-Hydroxysuccinimide Sulfonyl group Davidson, R. S.; Hilchenbach, M. M. Photochem. Photobiol. 1990, 52, 431. Ohio University Center for Intelligent Chemical Instrumentation

  7. How Dye Ester Linked with Sequencing Primer Ohio University Center for Intelligent Chemical Instrumentation

  8. The Structure of a Molecular Beacon Can be written as: Dye1-5’-GCGAGAAGTTAAGAACCTATGCTCGC-3’-Dye2 Dye2 Dye1 Ohio University Center for Intelligent Chemical Instrumentation

  9. Efficiency Evaluation of the MBs Ohio University Center for Intelligent Chemical Instrumentation

  10. Fluorescence Resonance Energy Transfer (FRET) FRET involves non-radiative transfer of electronic excitation from an excited donor, D* to a ground state acceptor molecule A, and occur at distances ranging from 10 to approximately 100 Å. E – Energy transfered – Förster critical distance R– Distance between the donor and acceptor . Hillisch, A.; Lorenz, M.; Diekmann, S. Curr. Opin. Struc. Biol. 2001, 11, 201. Ohio University Center for Intelligent Chemical Instrumentation

  11. Effect of Auto fluorescence Auto fluorescence of Gray Snapper (L.griseus) Oocyte http://www.diatronscience.com/AutoFluor.html. Ohio University Center for Intelligent Chemical Instrumentation

  12. My Goals of Designed Molecular Beacons • Longer wavelength to avoid background noise • Two Fluorophores • The two dyes chosen should be able to FRET Ohio University Center for Intelligent Chemical Instrumentation

  13. Choose Donor and Acceptor Dyes Ohio University Center for Intelligent Chemical Instrumentation

  14. FRET Between Cy3 and Cy5 Attached to a Coiled-coil of Homodimer Schematic drawing of a protein, Tyopomyosin, A coiled-coil in the native state is denatured into two polypeptide chains by denatureant, temperature and lowering salt concentration at room temperature. Thick lines represent α-helix and thin lines random coil polypeptide. Donor (D) and acceptor (A) fluorephores are labeled to a single cysteine residue at 190th position α-tropomyosin (αTm) Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. Ohio University Center for Intelligent Chemical Instrumentation

  15. Fluorescence Spectrum for Tm Labeled with Cy3 and Cy5 in Bulk Measurements Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. Ohio University Center for Intelligent Chemical Instrumentation

  16. Fluorescence images of FRET within a Single Protein Molecule • The donor (Cy3) images taken • with a band-pass filter of • 545-595 nm on excitation at the • donor • The acceptor (Cy5) images due • to FRE T taken with a band-pass • filter of 650-710 nm on excitation • at the donor Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. Ohio University Center for Intelligent Chemical Instrumentation

  17. Fluorescence Intensity of the Donor Fluorescence Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. Ohio University Center for Intelligent Chemical Instrumentation

  18. Fluorescence Intensity of the Increase in the Acceptor Fluorescence Due to FRET Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. Ohio University Center for Intelligent Chemical Instrumentation

  19. Fluorescence Spectrum from a single Cy3-Cy5-Labeled αTm molecule Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. Ohio University Center for Intelligent Chemical Instrumentation

  20. Time Records of the Donor and Acceptor Fluorescence from a Single Cy3-Cy5 Labeled αTm molecule Ishii, Y.; Yoshida, T.; Funatsu, T.; Wazawa, T.; Yanagida, T. Chem. Phys. 1999, 247, 163. Ohio University Center for Intelligent Chemical Instrumentation

  21. Designed MB and target DNA sequences _______________________________________________________________________ MB: 5’-Dye1-GCTCGTCCATGCCCAGGAAGGAGGCAACGACACGAGC-Dye2-3’ Target: 5’-GTCGTTGCCTCCTTCCTGGGCATGG-3’ ________________________________________________________________________ Dye1 Dye1=Cy3 Dye2=Cy5 Dye2 Dye1 Dye2 Ohio University Center for Intelligent Chemical Instrumentation

  22. Model of the D/A DNA Constructs with Varying Distance Dietrich, A.; Buschmann, V.; Mller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211. Ohio University Center for Intelligent Chemical Instrumentation

  23. Schematic Diagram of the Optical Setup 1) Frequency-doubled Nd:YAG (Neodymium) laser emitting at 532 nm 2) The collimated laser beam was directed into an inverted microscope and coupled into the microscope objective with high numerical apertures via a dichroic beam splitter 3) Within the microscope objective, the beam was focused into the sample to detect freely diffusing FRET constructs 4) The fluorescence light was collected through the same objective and imaged onto the active areas of two avalanche photodiodes 5) Need additional band pass filters in front of the APDs Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211 Ohio University Center for Intelligent Chemical Instrumentation

  24. Spectroscopic Characteristics of the Different FRET Constructs In Aqueous Buffer -- Relative fluorescence quantum yield of donor -- FRET energy of donor decreased -- FRET energy of acceptor increased Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211. Ohio University Center for Intelligent Chemical Instrumentation

  25. Fluorescence Emission Spectra of the Different FRET Constructs in Aqueous Buffer Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211. Ohio University Center for Intelligent Chemical Instrumentation

  26. FRET Histograms Extracted from Single Molecule Data of the Differently Labeled D/A Constructs and Corresponding Gaussian Fits Dietrich, A.; Buschmann, V.; Müller, C.; Sauer, M. Rev. Mol. Biotechnol. 2002, 82, 211. Ohio University Center for Intelligent Chemical Instrumentation

  27. A Fiber-Optic Evanescent Wave DNA Biosensor Based on This MB Advantages: • The DNA sensor based on a MB does not need labeled analyte or intercalation reagents. • Can be used to directly detect, in real time target DNA/RNA molecules without using competitive assays. • It is rapid, stable, highly selective, and reproducible. Ohio University Center for Intelligent Chemical Instrumentation

  28. Scheme of immobilization of biotinlyed MB DNA on optical fiber surface Liu, X; Tan, W. Anal. Chem. 1999, 71, 5054. Ohio University Center for Intelligent Chemical Instrumentation

  29. Dynamics of Hybridization of MB Evanescent Wave Sensor • Noncomplementary oligonucleotide • One-base-mismatched oligonucleotide • Complementary oligonucleotide • All in aqueous buffer containing 1 M NaCl Ohio University Center for Intelligent Chemical Instrumentation

  30. Experiment--Donors and Acceptors for the MBs Ohio University Center for Intelligent Chemical Instrumentation

  31. Four MBs Designed • 5’-Cy3-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’ • 5’-TMR-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’ • 5’-R6G-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-Cy5-3’ • 5’-TMR-GCTCGCCATGCCCAGGAAGGAGGCAACGACCGAGC-JA133-3’ Ohio University Center for Intelligent Chemical Instrumentation

  32. DNA Sequences Needed • Complementary DNA: CGAGCGGTACGGGTCCTTCCTCCGTTGCTGGCTCG • One-base-mismatch DNA: CGAGCGGTACGGGTCCTACCTCCGTTGCTGGCTCG • Two-base-mismatch DNA: CGAGCGGTACGGGTCCTAGCTCCGTTGCTGGCTCG • Non-complementary DNA: CGAAACCTGCGAATGGTAGCTCCAATGTGGAATCG Ohio University Center for Intelligent Chemical Instrumentation

  33. Estimation of the FRET parameters -- quantum yield of the donor k² -- orientation factor J -- overlap integral n -- refraction index of the medium R0 of the four investigated D/A pairs are: 63.5 for (R6G/Cy5) 64.5 for (TMR/Cy5) 55.8 for (Cy3/Cy5) 59.0 for (TMR/JA133) Ohio University Center for Intelligent Chemical Instrumentation

  34. Schematic of Experimental Setup Sample Microscope objective Beam splitter Laser source APD Personal computer Beam splitter Band-pass filters Counting board APD Ohio University Center for Intelligent Chemical Instrumentation

  35. Evaluation of efficiency for MBs Ohio University Center for Intelligent Chemical Instrumentation

  36. Cost Analysis • DNA sequences • <$300 • Molecular beacons • <$5000 • Optical Setup • <$5000 • Computer with software • <$6000 • Other Chemicals • <$2000 Ohio University Center for Intelligent Chemical Instrumentation

  37. Novelty of my work • FRET have been used to measure distances in protein structures and their assemblies in solution, have not been used in MB application yet. My proposal integrated FRET technique into MB. • Idea of two fluorophore MB were created in 2001, no such MB are created yet. My proposal created several MB that will have higher efficiency than current MBs. Ohio University Center for Intelligent Chemical Instrumentation

  38. CONCLUSIONS • A new strategy of designing MBs which uses two fluorophores (Cy3 and Cy5) instead of one fluorophore and one quencher as the donor and acceptor was proposed • MBs display high sensitivity and a large dynamic range • Such MBs are able to detect target DNA with 35 bases up to 1x10-7 M Ohio University Center for Intelligent Chemical Instrumentation

  39. Future Work • Studying protein-DNA/RNA interactions • Fluorescent immunoassay • DNA sequencing` • Other bio-molecular analyses Ohio University Center for Intelligent Chemical Instrumentation

  40. Dr. Pete B Harrington Mariela Ochoa Preshious Rearden Bryon Moore Acknowledgements Ohio University Center for Intelligent Chemical Instrumentation

More Related