slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Your hospital PowerPoint Presentation
Download Presentation
Your hospital

Loading in 2 Seconds...

  share
play fullscreen
1 / 37
garren

Your hospital - PowerPoint PPT Presentation

67 Views
Download Presentation
Your hospital
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. One Patient. Outpatient clinic Your hospital Commuting to work Your home Private healthcare specialist

  2. One Patient. One Record. Outpatient clinic Your hospital Commuting to work Your home Private healthcare specialist

  3. High Stakes SoftwareLife-Changing – Scalability – Real Time

  4. Designing for Safety

  5. Designing for Safety

  6. Designing for Safety

  7. Decision Support

  8. Innovation that transforms healthcare. Telemedicine and virtual doctor visits Personalized medicine Speech and gesture recognition Intuitive interfaces Patient engagement

  9. Virtual Visits

  10. EHR “to go”

  11. Innovation that transforms healthcare. Telemedicine and virtual doctor visits Personalized medicine Speech and gesture recognition Intuitive interfaces Patient engagement

  12. GTGGAACAATGTTCTGAAGAAAATTTGTGAAAGAAGGACGGGTCATCGCCTACTATTAGCAACAACGGTCGGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGCTAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACATGTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCGGTCGTATAAGTACAGTAGACCCTTCGCCGGCATCCTATTTATTAAGTTATTTCTACAGCAAAACGATCATATGCAGATCCGCAGTGGGCGGTAGACACACGTCCACCCGGCTGCTCTGTAACAGGGACTAAAGAGGTGATGATTATCGTGTGTGCCCCGTTATGGTCGTGTTCGATCAGAGCGCCCTTGCGAGCAGTCGTATGCTTTCTCGAATTCCGAGCGGTTAAGCGTGACAGTGTCATCGCCTACTATTAGCAACAACGGTCGGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGCTAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACATGTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCGGTCGTATAAGTACAGTAGACCCTTCGCCGGCATCCTATTTATTAAGTTATTTCTACAGCAAAACGATCATATGCAGATCCGCAGTGGGCGGTAGACACACGTCCACCCGGCTGCTCTGTAACAGGGACTAAAGAGGTGATGATTATCGTGTGTGCCCCGTTATGGTCGTGTTCGATCAGAGCGCCCTTGCGAGCAGTCGTATGCTTTCTCGAATTCCGAGCGGTTAAGCGTGACAGTCCCAGCGAACCCACAAAACGTGATCGCAGTCCATGCGATCATACAACAATGTTCTGAAGAAAATTTGTGAAAGAAGGACGGGTCATCGCCTACTATTAGCAACAACGGTCGGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGCTAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACATGTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCGGTCGTATAAGTACAGTAGACCCTTCGCCGGCATCCTATTTATTAAGTTATTTCTACAGCAAAACGATCATATGCAGATCCGCAGTGGGCGGTAGACACACGTCCACCCGGCTGCTCTGTAACAGGGACTAAAGAGGTGATGATTATCGTGTGTGCCCCGTTATGGTCGTGTTCGATCAGAGCGCCCTTGCGAGCAGTCGTATGCTTTCTCGAATTCCGAGCGGTTAAGCGTGACAGTCCCAGCGAACCCACAAAACGTGATCGCAGTCCATGCGATCATACGCAAGAAGGAAGGTCCCCATACACCGACGCACCAGTTTACACGCCGTATGCATAAACGAGCTGCACAAACGAGAGTGTTTGAACTGGACCTCTAGTTCCTCTACAAAGAACACCTTGACCTGTTGCGAAGTTGCCTTGCCTAGATGCAATGTCGGACGTATCACTTTTGCCTCAACGACTGCTGCTTTCGCTGTAACCCAAGACAGACAACAGTAACCGCCTTTTGAAGGCAAGTCCTCCGCCTGTGACTAACTGTGCCAAATCGTCTTCCAAACCCCTTATCCAATTTAACTCACCAAATTATTGCGATACAGACCCTAATTTCACATCATATGACACTAATTGCCTCTGCCAAAATTCTGTCCTCAAGCGTTTTAGTTCGCCCCAGTAATGTTGCCAATAAGGACCACCAAATCCGCATGTTACAGGACTTCTTATAAATTCTTTTTTCGTGGGGAGCAGCGGATCTTAATGGATGGCGCCAGCTGGTATGGAAGCTAATAGCGCCGGTGAGAGGGTAATCAGCCGTCTCCACCAACACAACGCTATCGGGTCATATTATAAGATTCCGCAATGGGACTACTTATAGGTTGCCTTAACGATATCCGCAACTTGCGATGTGCCTGCTATGCTTAAATACATACCTCGCCCAGTAGCTTTCCAATATGGGAACATCAATTGTACATCGGGCCGGGATAATCATGTCGTCACGGAACTTACTGTAAGAGTAATAATTCAAAAGAGATGTCGGTTTGCTAGTTCACGTAAAGGTGCCTCGCGCCACCTCTAAGTAAGTGAGCCGTCGAGACATTATCCCTGATTTTCTCACTACTATTAGTACTCACGGCGCAATACCACCACAGCCTTGTCTCGCCAGAATGCCGGTCAGCATATGGAAGAGCTCAAGGCAGGTCAATTCGCACTGTGAGGGTCACATGGGCGTTTGGCACTACCGACACGAACCTCAGTTAGCGTACATCCTACCAGAGGTCTGTGGCCCCGTGGTCAAAAGTGCGGGTTTCGTATTTGCTGCTCGTCTGTACTTTCAGAATCTTGACCTGCACGGCAAAGAGACGCTTTTTATGGAGCTCGACATGGCAACAACGCGACGGATCTACGTCACAACGAGAATAGTGTAAACGAAGCTGCTGACGGCGGAAGCGACATAGGGATCTGTGAGTTGTTATTCGCGAAAAACATCCGTCCCCGTGGGGGATAGTCACTGACGCGGTTTTGTAGAAGCCTAGGGGAACAGGTTAGTTTGACTAGCTTAAGAATGTAAATTCTGGGATTATACTGTAGTAATCACTAATTAACGGTGAGGGTTTTAAGACGGATCTTTGCAAATTCAAGCGAGGTGATTTCAACAAATTTTGCTGATGGTTTAGGCGTACAATCCCCTAAAGTATAATTAAGAAAATAGCATTCCTTGTCGCCTAGAATTACCTACCGGCGTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAGTCGGCACAAGTGGATGTGTTGCGATTGCCCGCTAAGATATTCTAAGGCGTAACGCAGATGAATATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGGGTCATTGAAGGGTTATACACTCGTAGTTAACAACGGGCCCGGCTCTATCAGAACACGAGTGCCTTGAATAACATACTCATCACTAAACTTTCTCAACAGTCAATCGAGCAAGTCCATTACCAAGGAGTGCGATGCAGTTTTATTCTCTCGCCAGCACTGTAATAGGCACTAAAAGAGTGATGATAATCATGAGTGCTGAGCTAAGACGGCGTCGGTACATAGCGGTCTTACGGTCAGTCGTAATTCCTCACGAGTCCCGTCCAGTTGAGCGTATCACTCCCAATGTACAAGCAACCCGAGAAGGCTGTGCTTGGAGTCAATCGGATGTAGGATGGTCTCCAGACACGGGGCCACCACTCTTCACGCGTAAAGCAAGAACGTCGAGCAGTCATGAAAGTCTTAGTACCGGACGTGCCGTTTTACTGCGAATATTACCTGAAGCTGTACCGTTATTGGGGGGCAAAGATGGAGTCCTCCTCTTATCATATTTGTATTGACGACAGCCGTGTTCCCGGTTTCCTCAGAGATTTAAGAATAAGGGCTTATTGTAGGCAGAGGGACGCCCTTTTAGTGGCTGGCGTAAAATATCTTCGGATCCCCTTGTCTAACCAGATTAATCGAATTCTCTCATTTAGGACCCTAGTAAGTCATCATTGGTGTTTAAATGCCACCCCGAAGAAACCGCCTAAAAATGTCTATGATTGGTCCACTAAAGTTGATTAAATCAACTCCTAAATCCGCGCGATAGGGCATTAGAGGTTTAATTTTGTATGGCAAGGTACTCCCGATCTTAATGAATGGCCGGAAGTGGTACGGACGCAATATGCGCGGGTGAGAGGGCAAATAGGCAGGTTCGCCTACGTTACGCTAGGGGGCGATTCTATAAGAATGCACATTGCATCGATACATAAGATGTCTCGACCGCATGCGCAACTTGTGAAGTGTCTACTATCCCTAAGCCCATTTCTCGCACAATAACCCCTGAATGTGTCCGCATCTGATGTTACCCGGGTTGAGTTAGTGTCGAGCTCGCGGAACTTATTGCATGAGTAGAGATATTGCTCTGTCCAGGACAACACGCGTAGTGAGAGTTACATGTTCGTTGGGTTCTCCCGACTCGGACCTGAGTCGACCAAGGACCCACTCGAGCTCTGAGCCCCACTGTCGAGAAGTATGTATCTCGCTCCCGCAGCTTGCCAGCACTTTCAGTATCATGGGGCCCATGGTTGAATGACTCCTATAACGGACTTCGACATGGCAAAATCCCCCCCTTGCAACTTCTAGAGGAGAAGAGTACTGACTTGAGCGCTCCCAGCACAACGGCCAAGGAAGTCTCCAATTTCTTGTTTCCGAATGACACGCGTCTCCTTGCGGGTAAATCGCCGACCGCAGGGAGCCAGGGGGAACAGATAGGTCTAATTAGGTTAAGGGAGTAAGTCCTCGGATGGTTCAGTTGTAACCATATACTTACGCTGGAACTTCTCCGGCGAATTTTTACTGTCACCAACCACGAGATTTGAGGTAAACCAATTGAGCACATAGTCGCGCTATCCGACAATCTCCAAATTATAACATACCGTTCCATGAAGGCCAGAGTTACTTACCGGCCCTTTCCATGCGCGCGCCATACCCCCCCAGTTCCCCGGTTATCTCTCCGAGGAGAGAGTGAGCGATCCTCCGTTAACATATTCTTACGTATGACGTAGCTATGTATTTTGCAGAGGTAGCGAACGGGTTTGACACTTCACAGATAGTGGGGATCCGGGCAAAGGGCGTATAATTGCGGTCCAACATAGGCGTAAACTACGATGGCACCAACTCAGTCGCAGCTCGTGCGCCGTGAATAACGTACTCATCCCGCTAGGGGACAGGTCCTGCGGCGTACATCACTTTGTATGTGCAACCAGCCCAAGTGGGGCCAGGCAAGACTCAGCTGGTTCCTGTGTTAGCTCGAGGCTAGGGATGACAGCTCTTTAAACATAGGCTGGGGGCGTCGAACGGTCGAGAAGCTCATAGTACCTCGGGTACCAACTTACTCAGGCTATTGCTTGAAGCTGTACTATTTCAGGGGGGGAGCGCTGATGGTCTCTTCTTCTGATGACTCAACTCGCAAGGGTCGTGAAGTCGGTTCCTTCAATGGTTAAAAATCAAAGGCTCACTGTGCAGACTGGAGCGCCCATCTAGCGGCTCGCGTCTCGAATGCTCGGTCCCCTTTGTCATTCCGGATAAATTCATACCCCTCATTCACTAGCTTGCGAAGTCTACATTGGTATATGAATCCGACCTAGAAGAGGGCACTTAAAATTGGGAGTGGTTGATGCTCTATATCCATTCGGTTTTTTCGTGCATCACCGCGAGAGGCTGACAAGGGTTTGACATTGAGTAGCAAGGCACTTCCGGACTCAATGAAGGGCCGGGAAAGGTACGCGCGTGGTATGGGAGGATCAAGGAGCCAATACAAAGGCTTCATCCTCACTCGCATGGAGGCAAACGCAGAACAATGGTTACTATTTCGATACGTGAAACATGTCCCACGGTAGCCCAAAGACTTAAGAGTCTATCACCCCTAGGGCCCTTTCCCGGATATAAACGCCAGGTTGAATCCGCATTTGGAGCTACGATGGATGAGTCTGGGTGGAGCGCGCCCCATTTATACCGTGAGTAGGGTCGACCAAGAACCGCAAGATGCGTCGGTGTACAAATAATTGTCAACAGACCGTCGTGTTTTGAAAATGGTACCAGCATCTTCGGGCGGTCTCAATCAAGCATGGATTACGGTGTTTACTCTGTCCTGCGGTTACCCATGGCCTGTAATCCAGCTCGAGTCAAGCCATTGCCTCTCTGGGACGCCGCATGAACTAATACGTATACTTTGCACGGGTTCACTGCGGTCCGTTCAGAGTCGACCAAGGACACAATCGAGCTCCCATCTGTATGCTCGACTAACTTGTACCCAACCCCCGGAGCTTGGCAGCTCCTGGGGTATCATGGAGCCTCTGGTTCATCCCGTGGGATATCAAGCTTCGTCTTGATAAAGCTCCCCGCTCGGGAGTAGCAGAGAAGACGCCTACTGAATTGTGCGATCCCTGCACCTCAGCTAAGGTAGCTACCAATATTTAGTTTCTAAGCCTTACGACAGACCTCGCACTTAGATTGCCATGCATAGAGCTAACGAGCCAGCGAAAAGCGTGAGGCGCTTTCAAGCATGGCGAGTAAGTGATCCAACGCTTCGGATACGACTATATACTTAGGTTTGATCTCGCCCCGAGAACTGTAAACCTCAACATTTATAGATTATGAGGTTAGCCGAAAATGCACGTGGTGGCGCCCGCCGACTGCTCCCAGAGTGTGGCTCTTTGTTCTGTCAAGGCCCGACCTTCATCGCGGCCGATTCCTTCTGCGGACCATGTCGTCCTGATACTTTGGTCATGTTTCCGTTGTAGGAGTGAACCCACTTGGCTTTGCGCCATAATTCCAATGAAAAACCTATGCACTTTGTTTAGGGTACCATCAGGAATCTGAACCCTCAGATAGTGGGGATCCCGGGTATAGACCTTTATCTGCGGTCCAACTTAGGCATAAACCTGCATGCTACCTTGTCAGACCCACTCTGCACGAAGTAAATATGGGATGCGTCCGACCTGGCTCCTGGCGTTCCACGCCGCCACGTGTTCGTTAACTGTTGATTGGTGGCACATAAGTAATACCATGGTCCCTGAAATTCGGCTCAGTTACTTCGAGCGTAATGTCTCAAATGGCGTAGAACGGCAATGACTGTTTGACACTAGGTGGTGTTCAGTTCGGTAACGGAGAGTCTGTGCGGCATTCTTATTAATACATTTGAAACGCGCCCAACTGACGCTAGGCAAGTCAGTGCAGGCTCCCGTGTTAGGATAAGGGTAAACATACAAGTCGATAGAAGATGGGTAGGGGCCTTCAATTCATCCAGCACTCTACGGTTCCTCCGAGAGCAAGTAGGGCACCCTGTAGTTCGAAGGGGAACTATTTCGTGGGGCGAGCCCACACCGTCTCTTCTGCGGAAGACTTAACACGTTAGGGAGGTGGAATAGTTTCGAACGATGGTTATTAATCGTAATAACGGAACGCTGTCTGGAGGATGAGTCTGACGGTGTGTAACTCGATCAGTCACTCGCTATTCGAACTGCGCGAAAGATCCCAGCGCTCATGCACTTGATTCCGAGGCCTGTCCCGATATATGAACCCAAACTAGAGCGGGGCTGTTGACGTTTGGAGTTGAAAAAATCTATTATACCAATCGGCTTCAACGTGCTCCACGGCAGGCGCCTGACGAGGGGCCCACACCGAGGAAGTAGACTGTTGCACGTTGGGGATAGCGCTAGCTAACAAAGACGCCTGCTACAACAGGAGTATCAAACCCGTACAAAGGGAACATCCACACTTTGGTGAATCGAAGCGCGGCATCAGGATTTCCTTTTGGATACCTGAAACAAAGCCCATCGTGGTCCTTAGACTTGGCACACTTACACCTGCAGCGCGCGCATGTGGAATTAGAGGCCAAGTTCGATCCCTACACCGACGTACGATGCAACTGTGTGGATGTGACGAGCTTCATTTATACGCTTCGCGCGCCGGACCGGCCTCCGCAAGGCGCAGCAGTGCACAAGCAAATGACAATTAACCACCGTGTATTCGTTATAGCATCAGGCAGTTTAAGTCGGGACAATAGGGGCCGCAATACACAGTTTACCGCATCTTGACCTAACTGACAAACTGCCATGGACGACTAGCCATGCCATTGGCTCTTAGACAGCCCGATACAGTGATTATGAAAGGTTTGCGGGGCATGGCTACGACTTGCTCAGCTACGTGCGAGGGCAGAAACTTTTCCGCATTTGTATGTTCACCTATCTACTACCCATGCCCGGAGATTATGTAGGTTGTGAGATGCGGGAGAGGTTCTCGATCTTCCCGTGGGACGTCAACCTTTCCCTTGATAAAGCATTCCGCTCGGGTATGGCAGTAAGTACGCCTTCTGAATTGTGCTAACCTTCATCCTTATCAAAGCTTGCTGCCAATGATTAGGATTATTGCCTTGCGACAGACTTCCTACTCACACTCGCTCACATTGAGCTACTCGATGGGCCATCAGCTTGACCCGCTCTGTAGGGTCGCGATTACGTGAGTTAGGGCTCCGGACTGCGCTGTATAGTCGAATCTGATCTCGCCCCCACAACTGCAAACCCCAACTTATTTAGATAACATGATTAGCCGAAGTTGCACGGGGTGCCCACCGTGGACTCCTCCCCGGGTGTCGCTCCTTCATCTGACAATATGCAGCCGCTACCACCATCGATTAATACAACGAACGGTGATGTTGTCATAGATTCGGCACATTTCCCTTGTAGGTGTGAAATCACTTAGCTTCGCGCCGAAGTCTTATGGCAAAACCGATGGACTATGTTTCGGGTAGCACCAGAAGTCTATAGCACGTGCATCCCAACGTGGCGTGCGTACACCTTAATCACCGCTTCATGCTAAGGTCCTGGCTGCATGCTATGTTGATACGCCTGCACTGCTCGAAGAAAATATACGAAGCGGGCGGCCTGGCCGGAGCACTACCGCATCGACGCGTATTCGAATACTGTTAATTGCTCACACATGAGCAAAATAGTAGACCGTCAATTTCAGCCCTCTTATCCTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATGGGTAGGGAGACCCAGAATCTATCGGCCTATGTCACTAAAACTTTCCAAACACCCCATGTCGATACTGAACGAATCGACGCACACTCCCTTCCTTGAAAACGCACAATCATACAACTGGGCACATAATGCGTACGCCCATCTAATACATCCAACTCTCTAAATGATTAGGATTATTGCCTTGGTCCTGTTCAAGAGCTGGAAGAGCACCCTCCACTTGGTCAAGTGATATCCTCGTAAGGCAAGCTCGTACCGTCATTCATGCGGAAGGGGTAAGACCATTAGAAGTAGGGATAGTCCCGAACCTCACTTACCACTCCCAATAAGGGATCCCTGTCTGAAGGATGAGTGTCAGCCAGTGTAACCCGATGAGGTACCCAGAAGCCGAACTGGGCCAGACAACCCGGCGCTAACGCACTCAAAGCCGGGACGCGACGCGACATATCGGCTAAGAGTAGGCCGGGAGTGTAGACCTTTGGGGTTGAATAAATCTGTCGTAGTAACCGGCTTCAACGACCCGTACAGGTGGCACTTCAGGAGGGGCCCGCAGGGAGGAAGTTTTCTGCTATTCGTGGCCGTTCGTGGTAACTAGTTGCGTTCCTAGCCACTACAATTGTTTCTAAGCCGTGTAATGAGAACAACCACACCATAGCGAATTGATGCGCCGCCTCGGAATACCGTTTTGGCAACCCCTTACTAAGGCCATCGCGATTTTCAGGTATCGTGCATGTAGGGTTGGACCGCACGCATGTTAAACTGCTGGCGAACCGCGATTCCACGACCGGTGCACGATTTAATTACGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCGCCCTCGTGATGGGGTAGCTGGGCATGACCTTGTGACATATAACGAGAGTCTACTTGTTTAATCATCTCACGGCGAAAGTCGGGGGGACAGCAGCCGCTGCAGACATTATACCGCAACTACACTAAGCTGAGATAACTCCGTAGTTGACTACGCATCCCTCTAGGCCTTACTTAACCGGATACAGTGACTTTGACAGGTTTGTGGGCTACAGCAATCACTTGCATAGCTGCGTATGGAGGAAGCAACTCTTGAGTGTTAATATGTTGACCCCTGTATTAGGGATGCGGGTAGTAGATGTGGGCAGAGACACCCAGGTCAAGTACATAACCCTCTCGTAGGAGGTGTTCCAGATCACCATACCACCATATCATTCGAGCATGACACTATGTACGCTGTCCCCATTCTGGTAGTCATCATCCCTATCACGGTTTCGAGTGACTGGTGACGGATATCCCCCACGAATGAAAATCTTATTCACAGTCGGTCATATTGGGGTGCTCCTTGGCTTTTCCGCTTGGCTCGGTCTGTTAGGCCTCCGTGCCCCGAGTTTCGGCGCTGTGCTGCCGAGAGTCGGCCATTGTCATTGGGGCCTCACTTGTGTGGAACAATGTTCTGAAGAAAATTTGTGAAAGAAGGACGGGTCATCGCCTACTATTAGCAACAACGGTCGGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGCTAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACATGTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCGGTCGTATAAGTACAGTAGACCCTTCGCCGGCATCCTATTTATTAAGTTATTTCTACAGCAAAACGATCATATGCAGATCCGCAGTGGGCGGTAGACACACGTCCACCCGGCTGCTCTGTAACAGGGACTAAAGAGGTGATGATTATCGTGTGTGCCCCGTTATGGTCGTGTTCGATCAGAGCGCCCTTGCGAGCAGTCGTATGCTTTCTCGAATTCCGAGCGGTTAAGCGTGACAGTGTCATCGCCTACTATTAGCAACAACGGTCGGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGCTAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACATGTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCGGTCGTATAAGTACAGTAGACCCTTCGCCGGCATCCTATTTATTAAGTTATTTCTACAGCAAAACGATCATATGCAGATCCGCAGTGGGCGGTAGACACACGTCCACCCGGCTGCTCTGTAACAGGGACTAAAGAGGTGATGATTATCGTGTGTGCCCCGTTATGGTCGTGTTCGATCAGAGCGCCCTTGCGAGCAGTCGTATGCTTTCTCGAATTCCGAGCGGTTAAGCGTGACAGTCCCAGCGAACCCACAAAACGTGATCGCAGTCCATGCGATCATACAACAATGTTCTGAAGAAAATTTGTGAAAGAAGGACGGGTCATCGCCTACTATTAGCAACAACGGTCGGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGCTAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACATGTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCGGTCGTATAAGTACAGTAGACCCTTCGCCGGCATCCTATTTATTAAGTTATTTCTACAGCAAAACGATCATATGCAGATCCGCAGTGGGCGGTAGACACACGTCCACCCGGCTGCTCTGTAACAGGGACTAAAGAGGTGATGATTATCGTGTGTGCCCCGTTATGGTCGTGTTCGATCAGAGCGCCCTTGCGAGCAGTCGTATGCTTTCTCGAATTCCGAGCGGTTAAGCGTGACAGTCCCAGCGAACCCACAAAACGTGATCGCAGTCCATGCGATCATACGCAAGAAGGAAGGTCCCCATACACCGACGCACCAGTTTACACGCCGTATGCATAAACGAGCTGCACAAACGAGAGTGTTTGAACTGGACCTCTAGTTCCTCTACAAAGAACACCTTGACCTGTTGCGAAGTTGCCTTGCCTAGATGCAATGTCGGACGTATCACTTTTGCCTCAACGACTGCTGCTTTCGCTGTAACCCAAGACAGACAACAGTAACCGCCTTTTGAAGGCAAGTCCTCCGCCTGTGACTAACTGTGCCAAATCGTCTTCCAAACCCCTTATCCAATTTAACTCACCAAATTATTGCGATACAGACCCTAATTTCACATCATATGACACTAATTGCCTCTGCCAAAATTCTGTCCTCAAGCGTTTTAGTTCGCCCCAGTAATGTTGCCAATAAGGACCACCAAATCCGCATGTTACAGGACTTCTTATAAATTCTTTTTTCGTGGGGAGCAGCGGATCTTAATGGATGGCGCCAGCTGGTATGGAAGCTAATAGCGCCGGTGAGAGGGTAATCAGCCGTCTCCACCAACACAACGCTATCGGGTCATATTATAAGATTCCGCAATGGGACTACTTATAGGTTGCCTTAACGATATCCGCAACTTGCGATGTGCCTGCTATGCTTAAATACATACCTCGCCCAGTAGCTTTCCAATATGGGAACATCAATTGTACATCGGGCCGGGATAATCATGTCGTCACGGAACTTACTGTAAGAGTAATAATTCAAAAGAGATGTCGGTTTGCTAGTTCACGTAAAGGTGCCTCGCGCCACCTCTAAGTAAGTGAGCCGTCGAGACATTATCCCTGATTTTCTCACTACTATTAGTACTCACGGCGCAATACCACCACAGCCTTGTCTCGCCAGAATGCCGGTCAGCATATGGAAGAGCTCAAGGCAGGTCAATTCGCACTGTGAGGGTCACATGGGCGTTTGGCACTACCGACACGAACCTCAGTTAGCGTACATCCTACCAGAGGTCTGTGGCCCCGTGGTCAAAAGTGCGGGTTTCGTATTTGCTGCTCGTCTGTACTTTCAGAATCTTGACCTGCACGGCAAAGAGACGCTTTTTATGGAGCTCGACATGGCAACAACGCGACGGATCTACGTCACAACGAGAATAGTGTAAACGAAGCTGCTGACGGCGGAAGCGACATAGGGATCTGTGAGTTGTTATTCGCGAAAAACATCCGTCCCCGTGGGGGATAGTCACTGACGCGGTTTTGTAGAAGCCTAGGGGAACAGGTTAGTTTGACTAGCTTAAGAATGTAAATTCTGGGATTATACTGTAGTAATCACTAATTAACGGTGAGGGTTTTAAGACGGATCTTTGCAAATTCAAGCGAGGTGATTTCAACAAATTTTGCTGATGGTTTAGGCGTACAATCCCCTAAAGTATAATTAAGAAAATAGCATTCCTTGTCGCCTAGAATTACCTACCGGCGTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAGTCGGCACAAGTGGATGTGTTGCGATTGCCCGCTAAGATATTCTAAGGCGTAACGCAGATGAATATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGGGTCATTGAAGGGTTATACACTCGTAGTTAACAACGGGCCCGGCTCTATCAGAACACGAGTGCCTTGAATAACATACTCATCACTAAACTTTCTCAACAGTCAATCGAGCAAGTCCATTACCAAGGAGTGCGATGCAGTTTTATTCTCTCGCCAGCACTGTAATAGGCACTAAAAGAGTGATGATAATCATGAGTGCTGAGCTAAGACGGCGTCGGTACATAGCGGTCTTACGGTCAGTCGTAATTCCTCACGAGTCCCGTCCAGTTGAGCGTATCACTCCCAATGTACAAGCAACCCGAGAAGGCTGTGCTTGGAGTCAATCGGATGTAGGATGGTCTCCAGACACGGGGCCACCACTCTTCACGCGTAAAGCAAGAACGTCGAGCAGTCATGAAAGTCTTAGTACCGGACGTGCCGTTTTACTGCGAATATTACCTGAAGCTGTACCGTTATTGGGGGGCAAAGATGGAGTCCTCCTCTTATCATATTTGTATTGACGACAGCCGTGTTCCCGGTTTCCTCAGAGATTTAAGAATAAGGGCTTATTGTAGGCAGAGGGACGCCCTTTTAGTGGCTGGCGTAAAATATCTTCGGATCCCCTTGTCTAACCAGATTAATCGAATTCTCTCATTTAGGACCCTAGTAAGTCATCATTGGTGTTTAAATGCCACCCCGAAGAAACCGCCTAAAAATGTCTATGATTGGTCCACTAAAGTTGATTAAATCAACTCCTAAATCCGCGCGATAGGGCATTAGAGGTTTAATTTTGTATGGCAAGGTACTCCCGATCTTAATGAATGGCCGGAAGTGGTACGGACGCAATATGCGCGGGTGAGAGGGCAAATAGGCAGGTTCGCCTACGTTACGCTAGGGGGCGATTCTATAAGAATGCACATTGCATCGATACATAAGATGTCTCGACCGCATGCGCAACTTGTGAAGTGTCTACTATCCCTAAGCCCATTTCTCGCACAATAACCCCTGAATGTGTCCGCATCTGATGTTACCCGGGTTGAGTTAGTGTCGAGCTCGCGGAACTTATTGCATGAGTAGAGATATTGCTCTGTCCAGGACAACACGCGTAGTGAGAGTTACATGTTCGTTGGGTTCTCCCGACTCGGACCTGAGTCGACCAAGGACCCACTCGAGCTCTGAGCCCCACTGTCGAGAAGTATGTATCTCGCTCCCGCAGCTTGCCAGCACTTTCAGTATCATGGGGCCCATGGTTGAATGACTCCTATAACGGACTTCGACATGGCAAAATCCCCCCCTTGCAACTTCTAGAGGAGAAGAGTACTGACTTGAGCGCTCCCAGCACAACGGCCAAGGAAGTCTCCAATTTCTTGTTTCCGAATGACACGCGTCTCCTTGCGGGTAAATCGCCGACCGCAGGGAGCCAGGGGGAACAGATAGGTCTAATTAGGTTAAGGGAGTAAGTCCTCGGATGGTTCAGTTGTAACCATATACTTACGCTGGAACTTCTCCGGCGAATTTTTACTGTCACCAACCACGAGATTTGAGGTAAACCAATTGAGCACATAGTCGCGCTATCCGACAATCTCCAAATTATAACATACCGTTCCATGAAGGCCAGAGTTACTTACCGGCCCTTTCCATGCGCGCGCCATACCCCCCCAGTTCCCCGGTTATCTCTCCGAGGAGAGAGTGAGCGATCCTCCGTTAACATATTCTTACGTATGACGTAGCTATGTATTTTGCAGAGGTAGCGAACGGGTTTGACACTTCACAGATAGTGGGGATCCGGGCAAAGGGCGTATAATTGCGGTCCAACATAGGCGTAAACTACGATGGCACCAACTCAGTCGCAGCTCGTGCGCCGTGAATAACGTACTCATCCCGCTAGGGGACAGGTCCTGCGGCGTACATCACTTTGTATGTGCAACCAGCCCAAGTGGGGCCAGGCAAGACTCAGCTGGTTCCTGTGTTAGCTCGAGGCTAGGGATGACAGCTCTTTAAACATAGGCTGGGGGCGTCGAACGGTCGAGAAGCTCATAGTACCTCGGGTACCAACTTACTCAGGCTATTGCTTGAAGCTGTACTATTTCAGGGGGGGAGCGCTGATGGTCTCTTCTTCTGATGACTCAACTCGCAAGGGTCGTGAAGTCGGTTCCTTCAATGGTTAAAAATCAAAGGCTCACTGTGCAGACTGGAGCGCCCATCTAGCGGCTCGCGTCTCGAATGCTCGGTCCCCTTTGTCATTCCGGATAAATTCATACCCCTCATTCACTAGCTTGCGAAGTCTACATTGGTATATGAATCCGACCTAGAAGAGGGCACTTAAAATTGGGAGTGGTTGATGCTCTATATCCATTCGGTTTTTTCGTGCATCACCGCGAGAGGCTGACAAGGGTTTGACATTGAGTAGCAAGGCACTTCCGGACTCAATGAAGGGCCGGGAAAGGTACGCGCGTGGTATGGGAGGATCAAGGAGCCAATACAAAGGCTTCATCCTCACTCGCATGGAGGCAAACGCAGAACAATGGTTACTATTTCGATACGTGAAACATGTCCCACGGTAGCCCAAAGACTTAAGAGTCTATCACCCCTAGGGCCCTTTCCCGGATATAAACGCCAGGTTGAATCCGCATTTGGAGCTACGATGGATGAGTCTGGGTGGAGCGCGCCCCATTTATACCGTGAGTAGGGTCGACCAAGAACCGCAAGATGCGTCGGTGTACAAATAATTGTCAACAGACCGTCGTGTTTTGAAAATGGTACCAGCATCTTCGGGCGGTCTCAATCAAGCATGGATTACGGTGTTTACTCTGTCCTGCGGTTACCCATGGCCTGTAATCCAGCTCGAGTCAAGCCATTGCCTCTCTGGGACGCCGCATGAACTAATACGTATACTTTGCACGGGTTCACTGCGGTCCGTTCAGAGTCGACCAAGGACACAATCGAGCTCCCATCTGTATGCTCGACTAACTTGTACCCAACCCCCGGAGCTTGGCAGCTCCTGGGGTATCATGGAGCCTCTGGTTCATCCCGTGGGATATCAAGCTTCGTCTTGATAAAGCTCCCCGCTCGGGAGTAGCAGAGAAGACGCCTACTGAATTGTGCGATCCCTGCACCTCAGCTAAGGTAGCTACCAATATTTAGTTTCTAAGCCTTACGACAGACCTCGCACTTAGATTGCCATGCATAGAGCTAACGAGCCAGCGAAAAGCGTGAGGCGCTTTCAAGCATGGCGAGTAAGTGATCCAACGCTTCGGATACGACTATATACTTAGGTTTGATCTCGCCCCGAGAACTGTAAACCTCAACATTTATAGATTATGAGGTTAGCCGAAAATGCACGTGGTGGCGCCCGCCGACTGCTCCCAGAGTGTGGCTCTTTGTTCTGTCAAGGCCCGACCTTCATCGCGGCCGATTCCTTCTGCGGACCATGTCGTCCTGATACTTTGGTCATGTTTCCGTTGTAGGAGTGAACCCACTTGGCTTTGCGCCATAATTCCAATGAAAAACCTATGCACTTTGTTTAGGGTACCATCAGGAATCTGAACCCTCAGATAGTGGGGATCCCGGGTATAGACCTTTATCTGCGGTCCAACTTAGGCATAAACCTGCATGCTACCTTGTCAGACCCACTCTGCACGAAGTAAATATGGGATGCGTCCGACCTGGCTCCTGGCGTTCCACGCCGCCACGTGTTCGTTAACTGTTGATTGGTGGCACATAAGTAATACCATGGTCCCTGAAATTCGGCTCAGTTACTTCGAGCGTAATGTCTCAAATGGCGTAGAACGGCAATGACTGTTTGACACTAGGTGGTGTTCAGTTCGGTAACGGAGAGTCTGTGCGGCATTCTTATTAATACATTTGAAACGCGCCCAACTGACGCTAGGCAAGTCAGTGCAGGCTCCCGTGTTAGGATAAGGGTAAACATACAAGTCGATAGAAGATGGGTAGGGGCCTTCAATTCATCCAGCACTCTACGGTTCCTCCGAGAGCAAGTAGGGCACCCTGTAGTTCGAAGGGGAACTATTTCGTGGGGCGAGCCCACACCGTCTCTTCTGCGGAAGACTTAACACGTTAGGGAGGTGGAATAGTTTCGAACGATGGTTATTAATCGTAATAACGGAACGCTGTCTGGAGGATGAGTCTGACGGTGTGTAACTCGATCAGTCACTCGCTATTCGAACTGCGCGAAAGATCCCAGCGCTCATGCACTTGATTCCGAGGCCTGTCCCGATATATGAACCCAAACTAGAGCGGGGCTGTTGACGTTTGGAGTTGAAAAAATCTATTATACCAATCGGCTTCAACGTGCTCCACGGCAGGCGCCTGACGAGGGGCCCACACCGAGGAAGTAGACTGTTGCACGTTGGGGATAGCGCTAGCTAACAAAGACGCCTGCTACAACAGGAGTATCAAACCCGTACAAAGGGAACATCCACACTTTGGTGAATCGAAGCGCGGCATCAGGATTTCCTTTTGGATACCTGAAACAAAGCCCATCGTGGTCCTTAGACTTGGCACACTTACACCTGCAGCGCGCGCATGTGGAATTAGAGGCCAAGTTCGATCCCTACACCGACGTACGATGCAACTGTGTGGATGTGACGAGCTTCATTTATACGCTTCGCGCGCCGGACCGGCCTCCGCAAGGCGCAGCAGTGCACAAGCAAATGACAATTAACCACCGTGTATTCGTTATAGCATCAGGCAGTTTAAGTCGGGACAATAGGGGCCGCAATACACAGTTTACCGCATCTTGACCTAACTGACAAACTGCCATGGACGACTAGCCATGCCATTGGCTCTTAGACAGCCCGATACAGTGATTATGAAAGGTTTGCGGGGCATGGCTACGACTTGCTCAGCTACGTGCGAGGGCAGAAACTTTTCCGCATTTGTATGTTCACCTATCTACTACCCATGCCCGGAGATTATGTAGGTTGTGAGATGCGGGAGAGGTTCTCGATCTTCCCGTGGGACGTCAACCTTTCCCTTGATAAAGCATTCCGCTCGGGTATGGCAGTAAGTACGCCTTCTGAATTGTGCTAACCTTCATCCTTATCAAAGCTTGCTGCCAATGATTAGGATTATTGCCTTGCGACAGACTTCCTACTCACACTCGCTCACATTGAGCTACTCGATGGGCCATCAGCTTGACCCGCTCTGTAGGGTCGCGATTACGTGAGTTAGGGCTCCGGACTGCGCTGTATAGTCGAATCTGATCTCGCCCCCACAACTGCAAACCCCAACTTATTTAGATAACATGATTAGCCGAAGTTGCACGGGGTGCCCACCGTGGACTCCTCCCCGGGTGTCGCTCCTTCATCTGACAATATGCAGCCGCTACCACCATCGATTAATACAACGAACGGTGATGTTGTCATAGATTCGGCACATTTCCCTTGTAGGTGTGAAATCACTTAGCTTCGCGCCGAAGTCTTATGGCAAAACCGATGGACTATGTTTCGGGTAGCACCAGAAGTCTATAGCACGTGCATCCCAACGTGGCGTGCGTACACCTTAATCACCGCTTCATGCTAAGGTCCTGGCTGCATGCTATGTTGATACGCCTGCACTGCTCGAAGAAAATATACGAAGCGGGCGGCCTGGCCGGAGCACTACCGCATCGACGCGTATTCGAATACTGTTAATTGCTCACACATGAGCAAAATAGTAGACCGTCAATTTCAGCCCTCTTATCCTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATGGGTAGGGAGACCCAGAATCTATCGGCCTATGTCACTAAAACTTTCCAAACACCCCATGTCGATACTGAACGAATCGACGCACACTCCCTTCCTTGAAAACGCACAATCATACAACTGGGCACATAATGCGTACGCCCATCTAATACATCCAACTCTCTAAATGATTAGGATTATTGCCTTGGTCCTGTTCAAGAGCTGGAAGAGCACCCTCCACTTGGTCAAGTGATATCCTCGTAAGGCAAGCTCGTACCGTCATTCATGCGGAAGGGGTAAGACCATTAGAAGTAGGGATAGTCCCGAACCTCACTTACCACTCCCAATAAGGGATCCCTGTCTGAAGGATGAGTGTCAGCCAGTGTAACCCGATGAGGTACCCAGAAGCCGAACTGGGCCAGACAACCCGGCGCTAACGCACTCAAAGCCGGGACGCGACGCGACATATCGGCTAAGAGTAGGCCGGGAGTGTAGACCTTTGGGGTTGAATAAATCTGTCGTAGTAACCGGCTTCAACGACCCGTACAGGTGGCACTTCAGGAGGGGCCCGCAGGGAGGAAGTTTTCTGCTATTCGTGGCCGTTCGTGGTAACTAGTTGCGTTCCTAGCCACTACAATTGTTTCTAAGCCGTGTAATGAGAACAACCACACCATAGCGAATTGATGCGCCGCCTCGGAATACCGTTTTGGCAACCCCTTACTAAGGCCATCGCGATTTTCAGGTATCGTGCATGTAGGGTTGGACCGCACGCATGTTAAACTGCTGGCGAACCGCGATTCCACGACCGGTGCACGATTTAATTACGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCGCCCTCGTGATGGGGTAGCTGGGCATGACCTTGTGACATATAACGAGAGTCTACTTGTTTAATCATCTCACGGCGAAAGTCGGGGGGACAGCAGCCGCTGCAGACATTATACCGCAACTACACTAAGCTGAGATAACTCCGTAGTTGACTACGCATCCCTCTAGGCCTTACTTAACCGGATACAGTGACTTTGACAGGTTTGTGGGCTACAGCAATCACTTGCATAGCTGCGTATGGAGGAAGCAACTCTTGAGTGTTAATATGTTGACCCCTGTATTAGGGATGCGGGTAGTAGATGTGGGCAGAGACACCCAGGTCAAGTACATAACCCTCTCGTAGGAGGTGTTCCAGATCACCATACCACCATATCATTCGAGCATGACACTATGTACGCTGTCCCCATTCTGGTAGTCATCATCCCTATCACGGTTTCGAGTGACTGGTGACGGATATCCCCCACGAATGAAAATCTTATTCACAGTCGGTCATATTGGGGTGCTCCTTGGCTTTTCCGCTTGGCTCGGTCTGTTAGGCCTCCGTGCCCCGAGTTTCGGCGCTGTGCTGCCGAGAGTCGGCCATTGTCATTGGGGCCTCACTTGT Preventive CareMost Appropriate Care Mass Correlations Genomics

  13. Innovation that transforms healthcare. Telemedicine and virtual doctor visits Personalized medicine Speech and gesture recognition Intuitive interfaces Patient engagement

  14. Touch…

  15. … Without Touch Gesture Controlled User Interaction

  16. Share with Patients

  17. Innovation that transforms healthcare. Telemedicine and virtual doctor visits Personalized medicine Speech and gesture recognition Intuitive interfaces Patient engagement

  18. Better Ways to Visualize Information

  19. Personalized Goal Dashboards

  20. Maintain a Personal Health Model

  21. Innovation that transforms healthcare. Telemedicine and virtual doctor visits Personalized medicine Speech and gesture recognition Intuitive interfaces Patient engagement

  22. Hospital MyChart

  23. MyChart for the iPhone

  24. Personal Health Monitoring

  25. Government Incentives & Regulations Physician Quality Reporting Meaningful Use NCQA / HEDIS Medical Home Accountable Care The Joint Commission Bundled Payments

  26. Customers FLORIDA Dallas, TX

  27. President Obama at Cleveland Clinic

  28. Dedicated to innovation. 5,200 employees as of January 2012

  29. Stable growth in size…

  30. Life at Epic

  31. Intergalactic Headquarters Epic’s Verona Campus

  32. Some Teams & Roles at Epic • ADT – Prelude • EpicCare Ambulatory • EpicCare Inpatient • Orders • Specialties (Oncology, Radiology, Cardiology, etc.) • Pharmacy • Billing • Software Developer • Quality Assurance • Implementation Services • Technical Services

  33. Product Life Cycle Immersions & Design Feedback Development & Continued Design Developer Testing Quality Assurance Product Testing Release Testing Implementation / Install / Upgrade Technical Support

  34. ~40% of U.S. population cared for by EpicCare 140,000,000 patients Providing care for someone close to you… Who we are

  35. Questions? Christina Ring Technical Services cring@epic.com 608-271-9000