550 likes | 796 Views
SNPs Future Application. Where have we been….. ….where are we going?. Diagnostics in the Past. Have you had this before?. …..Well you’ve got it again !. Restriction Length Polymorphism. Reverse Blot Hybridization. STR (Short Tandem Repeats). CCTAC ATTG ATTG ATTG ATTG ATTG AAGCA.
E N D
Diagnostics in the Past Have you had this before? …..Well you’ve got it again !
STR (Short Tandem Repeats) CCTACATTG ATTG ATTG ATTG ATTG AAGCA
ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG Down to level of DNA seq
ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG Down to level of DNA seq
ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG Mitochondrial DNA • Relatively small circular DNA molecule • Treated as one loci • Differences in sequence treated as alleles
SNPs (Single Nucleotide Polymorphisms) • Polymorphisms that differ by one base pair • Typically Bi-allelic • Estimated to be approximately 3,000,000 in the Human genome • May be useful in Gene Mapping, Medical Diagnostic and Forensic applications
ATCGTACGGTTTAAAAGCCTAGTCAGCTTACGG ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG ATCGTACGGTTTAAACGCCTAGTCAGCTTACGG ATCGTACGGTTTAAATGCCTAGTCAGCTTACGG Allele 1 Allele 2 Allele 3 Allele 4
Will SNPs Replace STRs Science & Justice Volume 44 No.1 (2004) 51 - 53 Peter Gill FSS David J. Werrett Bruce Budowle FBI Richard Guerrieri
Will SNPs Replace STRs • Databases already exist and would be costly to replaced in ever jurisdiction • Cost is not a clear advantage at this point • Extensive multiplexing (50 to 100 loci) would be required for forensic samples
Will SNPs Replace STRs • Mixtures would be hard to interpret given the limited number of alleles at each SNP • Low copy number analysis may produce big problems like allelic drop etc…. • Probably used in specialized situations - mtDNA, Y, eye color, mass disaster
Will SNPs Replace STRs “..……Neither mass-disaster nor paternity analysis is dependent upon national DNA databases. This means that for the initial introduction, standardization is not a necessity. Provided that analyses are carried out using the same set of loci then standardization is achieved by default on a per-case basis……”
Will SNPs Replace STRs “…..The process of standardization can follow a specific route proposed here. It will require co-ordination by a committee of experts. In Europe, experts will be drawn from the ENFSI and in North America experts will be drawn from SWGDAM. These will comprise the SNP standardization group. Information flow will follow by exchange of ENFSI members and SWGDAM members at each other’s meetings. Eventually, a standard set of loci will be chosen by mutual agreement……”
Determination of Ancestral Affiliation and Physical Characteristics
“Fast-breeding, slow-flying fruit flies are much easier to study than highly mobile mammals with 25 years between generations whose common ancestry goes back tens of thousands of years. “ John Relethford (SUNY Oneonta, N.Y) - Genes generate a map; Monday, June 9, 2003
Requirement • Markers • Accurate understanding of: - Evolution - Migration - Ancestral Groups - Phenotype
Evolution ? • Still debate here, but a sharper picture as time goes by
Evolution and Migration • Single Origin • Multi-Regional
STR and Y-Chromosome Studies • Timing of the critical first branching harder to estimate than later branches that shaped modern Homo sapiens. • Hunter-gatherers in Africa diverged from a common ancestral population between 70,000 years and 140,000 years ago • Expanded out of Africa to Eurasia, East Asia, Oceania and last to the Americas
STR and Y-Chromosome Studies • A genetically distinct group of sub-Saharan farmers appeared 7,000 to 10,000 years after hunter-gatherers became established and migrated to Eurasia 13,000 to 19,000 years later • Y-Chromosome studies indicate that migration out of Africa happened about 66,000 years ago. • Latest studies suggest the size of this original group must have been tiny, no more than 2,000 individuals.
Test for Ancestral Inference • 176 SNPs - Ancestry Informative Markers (AIM) • - Majority in Pigmentation and Xenobiotic • Metabolism genes • Automated Sequencing of SNPs to generate genotypes • Classifier (percent affiliation) - Four anthropologic groups • - Native American, European, sub-Saharan African, East Asian
Issues for Discussion • Accuracy: • -In the range of 1 in 100 misclassifications • - Probably only suitable for Inference of Major Ancestral Affiliation • Presumptive?
Issues for Discussion • Contributing to Accuracy Issues: • - Self reporting • - Admixture • - Unpredicted mixtures • - Linkage
Issues for Discussion • Confusing Race with Ancestry • - Race to some extent is becoming meaningless • - Distinctions between groups are growing fuzzy • - Variations between individuals within a “Race” may be more pronounced than differences between one races
“ We are all mixed up, part of the same family tree originally, who then evolved, then were together and mixed up again.” • Mark Shriver, assistant professor of anthropology and genetics at Penn State University
Issues for Discussion • Use for probable cause • Dragnets
Issues for Discussion • Use of such tests to delineate which Racial groups to select for Match Statistics • Will this be fair to individuals or groups possessing high degrees of Ancestral Homogeneity?
Issues for Discussion • Which Racial group will we use for Match Statistics when an individual has a high degree of Ancestral Heterogeneity? • Will we need to revisited old cases?
Issues for Discussion • Cost$ • - What will they be? • - Will such expenditures be justifiable in light of testing backlogs and tight budgets?