770 likes | 936 Views
Science Writing for Research Part II. Editing. Instructor: Richard Rothenberg MD Office: 140 Decatur St. Atlanta GA 30302-3995 Phone: 404-413-1144 Email: rrothenberg@gsu.edu , rrothen@emory.edu. M a crostrucure vs. M i crostructure. MACRO Abstract Introduction Methods Results
E N D
Science Writing for ResearchPart II. Editing Instructor: Richard Rothenberg MD Office: 140 Decatur St. Atlanta GA 30302-3995 Phone: 404-413-1144 Email: rrothenberg@gsu.edu, rrothen@emory.edu
Macrostrucure vs. Microstructure MACRO Abstract Introduction Methods Results Conclusion MICRO Paper Section Paragraph Sentence Word Words and Rules
Combinatorics WORDS: Combinations of sounds (phonemes) that have specific meanings by common agreement. RULES: The GRAMMAR (set of rules) by which words are combined.
Combinatorics The combinations are effectively infinite. Words and rules provide the vehicle for expressing any idea that humans might care to have. Some languages are similar in both words and rules (English and Spanish). Some are vastly different (Hungarian and Chinese). The general concept applies to all language.
Combinatorics Reading and writing are probably in a separate domain from speech. Spoken language “comes naturally.” (It’s hard-wired.) Writing has to be learned. The relationship is symbiotic: words and rules are motivated by meaning, and meaning is only possible through words and rules.
Combinatorics Therefore, to convey meaning… You have to know what words mean. You have to know the rules.
The Rosetta Stone Hieroglyphics Demotic Egyptian Greek
cgctagaagcttgcatagatgagataggtagtgttcgccttgatataactcaatgttaaa caccgcggtgttgctcttagatttgtatctcgatgagcgccagaaaagctactacaggcc gaaatatttttatatgcgatttccttcaccgcgccgtatggcgatcaaggtcagatgcgt aacggagtggttctcgattatgagaatactggttctcttatctacctatcacaatccttc acagattcgtctttgtgtctctcatggcgcgtgagtcagtgttattaagtcaaagtgaat gtcttttggtgtccatccttgtctcaggaactgcgcttcgttctggagtagggacctgtg cgtaatccactccctgatctagtcccttcgcatcgagagcatccatagagatctggaccc cttgggtactcaccccggtttcaacggggaggatatcgagcttcaatcggtgaagatgct tccgccgtgtgcggcagtttattcttcctgcgaagtccttacgtcgggctcagtttttga tagttgcactcattaatcagcctcgccaactttaggggcgcaggtcgcgagaacatcgaa tctcgtaggccgcggcgatccggtcacacataatgaacggaagttgtcgatattcgatgc tcttcgatgctggtatctgactatcccgtcattacttcatcggctgtctagaccagctgc gtgctcgtaggcccataacgatcaaaccaaaatgaaactatactatagcggaggcaaaat cacatgcctccagggccggtgacacctagactcggccagggtaattatcctgacgcaatg acacttatagtcggaaccctgaaagcggaaatcgcaccaaagtcaggactggctctgtaa acgagtcaggtcccgaaccaagcccgactttcgtccctggtgtagattgttcacgtcttc tgctcctcataaggtgcaaaattgcacagcagtcctgagt
Complete DNA sequence of canine adenovirus type 1 (schematic) J Gen Virology 1997;78:873-878
First major rule of grammar. • A sentence has a subject and a verb • Subject = the main thing • Verb = what happens
My concern has been the atrocities there in Darfur and the relevance to me with that issue as we spoke about Africa and some of the countries there that were kind of the people succumbing to the dictators and the corruption of some collapsed governments on the continent, the relevance was Alaska’s investment in Darfur with some of our permanent fund dollars. 62 words
My concern has been the atrocities there in Darfur and the relevance to me with that issue as we spoke about Africa and some of the countries there that were kind of the people succumbing to the dictators and the corruption of some collapsed governments on the continent, the relevance was Alaska’s investment in Darfur with some of ourpermanent fund dollars.
My concern has been theatrocitiesthere inDarfurand therelevanceto me with that issue as we spoke aboutAfrica and some of the countries there that were kind of the people succumbing to thedictators and thecorruptionof somecollapsed governments on the continent, therelevance was Alaska’s investment in Darfur with some of ourpermanent fund dollars. The atrocities in Darfur, a manifestation of corrupt dictatorships and collapsed governments in Africa, affect Alaska’s permanent fund investments.
Exercise A Jedi craves not these things. Nothing more will I teach you today. --SW 5 The Moving Finger writes; and, having writ, Moves on: nor all your Piety nor Wit Shall lure it back to cancel half a Line, Nor all your Tears wash out a Word of it Fitzgerald, The Rubiayat
Exercise I was like yeah and she was like no way.
Exercise A well regulated Militia, being necessary to the security of a free State, the right of the people to keep and bear Arms, shall not be infringed.
Brrrng….brrrrrng…. Hello. You have reached the XYZ Company. Please listen carefully to the following options, as our menu has changed. For sales, press ONE. For customer service, press TWO. For technical…..YOU PRESS TWO…. All our representatives are busy helping other customers. Your call is very important to us, so please stay on the line for the next available operator. Your call will be answered in the order in which it was received.
Second major rule of grammar. You can’t tell the players without a scorecard. Identify the role that each word plays in the sentence.
The parts of speech (common) • Verb shows action or state of being • Predicate the main action word in a sentence • Noun name of something • Subject the main noun in a sentence • Object a noun to which something is done • Pronoun takes the place of a noun • Adjective modifies a noun or pronoun • Article a, an (indefinite); the (definite) • Adverb modifies a verb, adjective, or adverb • Preposition relates a noun or pronoun to another word • Conjunction joins words or groups of words • Interjection shows strong feeling
Parts of speech (less common…weird) • Predicate nominative • Predicate adjective • Appositive • Transitive verb • Intransitive verb • Gerund (or gerundive) • Present participle • Past participle • Infinitive • Verbal • Verb phrase • Noun phrase • Object (direct) • Object (indirect) • Subject complement • Object complement
Prepositions Key prepositions: to in on from by with at
Coordinating Conjunctions and or but nor so for yet after although as as if as long as because before even if even though if once provided since so that that though till unless until what when whenever wherever whether while Subordinating Conjunctions
Editing steps -- 1 • Count the words • Identify what part of speech each word is playing • Identify the subject and the verb • See how far apart the subject and the verb are (how much has been shoved in between them) • Cut out all modifying words and phrases • You should be left with <10 words
Editing Steps -- 2 • Does this “bare bones” version convey the underlying meaning? • If yes, add some important stuff back in. • “important” means: serves the meaning of the sentence • Take a second look at what you left out. Did it matter? • If no, decide on the “real” subject and verb • Rewrite the sentence a new way. • Start with the “real” noun. • Try a stronger verb that may have been “lurking” • Start with a modifying phrase • Steal from other sentences • Add stuff back in , as above.
Editing Algorithm Take everything out except crucial modifiers. YES Do they capture the meaning? YES Make sure you have captured the meaning. NO Does it have a subject and a verb? A sentence Put stuff back in. Find the noun and verb that capture the meaning Count the words NO Rewrite the minimal sentence. If (~) > 20, then reconsider. Put stuff back in.
Naming the parts of a sentence Emory is a destination University. N Aj V At NS
Naming the parts of a sentence Recognition of ligands on target cells by cognate receptors on acceptor cells such as B cells, T cells, or NK cells can lead to transfer of the ligand and closely associated membrane fragments from the target cell to the acceptor cell. Pp Pp Aj NO Pp NO NO NS Aj Pp NO Pp Aj C Aj NO NO V NO Aj Aj Aj At Av V Pp Pp C NO NO Aj At At NO Aj Aj NO Pp Pp NO The Journal of Immunology, 2008, 181: 8120–8132
Naming the parts of a sentence Pp Pp Aj NO Pp NS NO NO Aj Pp NO Pp Aj C Aj NO NO V NO Aj Aj Aj At Av V Pp Pp C NO NO Aj At At NO Aj Aj NO Pp Pp NO The Journal of Immunology, 2008, 181: 8120–8132
Naming the parts of a sentence NO Aj Pp Pp Aj Pp NO V Pp NO N V NO Aj Pp C NO Aj NO NO Aj Aj Aj Aj Av Pp NO C NO Pp At Aj NO At Pp Aj At NO NO Pp The Journal of Immunology, 2008, 181: 8120–8132
Finding the meaning Recognition of ligands on target cells by cognate receptors on acceptor cells such as B cells, T cells, or NK cells can lead to transfer of the ligand and closely associated membrane fragments from the target cell to the acceptor cell. (41 words) If acceptor cells recognize ligands on target cells, the ligands and membrane fragments may be transferred from the target cell to the acceptor cell. (23 words) Start with a phrase Target cells can transfer ligands to acceptor cells. (8 words) Use a lurking verb
Finding the meaning Recognition of ligands on target cells by cognate receptors on acceptor cells such as B cells, T cells, or NK cells can lead to transfer of the ligand and closely associated membrane fragments from the target cell to the acceptor cell. Target cells can transfer ligands to acceptor cells. Target cells can transfer ligands and associated membrane fragments to acceptor cells. Target cells can transfer ligands and associatedmembrane fragments to acceptor cells that have cognate (appropriate) receptors. Target cells can transfer ligands and associated membrane fragments to acceptor cells, such as B, T, or NK cells, that have cognate receptors.
Finding the meaning Recognition of ligands on target cells by cognate receptors on acceptor cells such as B cells, T cells, or NK cells can lead to transfer of the ligand and closely associated membrane fragments from the target cell to the acceptor cell. Target cells can transfer ligands and associated membrane fragments to acceptor cells(e.g., B, T, or NK cells) that have cognate receptors.
Exercise While lagging strand synthesis, however, is a discontinuous process, which utilizes many replication- initiating events and more proteins are required for lagging strand synthesis because additional replication forks are needed to complete DNA replication. C At Aj NS C V Aj N Pn Aj Aj V Aj Aj C V NS Aj Pn NO C Aj NO Aj Aj Aj Aj V N V N DNA Repair 2007;6(9): 1307-1318
Exercise While lagging strand synthesis, however, is a discontinuous process, which utilizes many replication- initiating events and more proteins are required for lagging strand synthesis because additional replication forks are needed to complete DNA replication. Lagging strand synthesis is a discontinuous process that uses many replication-initiating events. More proteins are required for lagging strand synthesis because additional replication forks are needed to complete DNA replication.
Exercise Results of coronary angiography were expressed as 1-, 2-, or 3- vessel disease based on 50% lumen diameter narrowing in any of the 3 coronary arteries or their major branches. Angiograms and myocardial perfusion images were interpreted blindly without knowledge of each other.* *Obviously, angiograms and myocardial perfusion images had never met. Am J Cardiol 2008;102:1451–1456
Exercise To the extent that the poor suffer predominantly from health problems for which cost-effective solutions exist, the nexus of poverty and health should be weakened because the cost of care for them should be lower than for the non-poor. Because cost-effective solutions exist for the health problems of the poor, disrupting the nexus of poverty and health should lower the cost of health care for the poor. Musgrove, Poverty and Health, p 52
Transitions: the 3-sentence moving average • When you come to the end of a paragraph: • Read three sentences together • Focus on the middle one • Read the one before it • Read the one after it • Do the three together make sense? • Does the middle one follow after the previous, and lead to the next?
Words and Rules Macrostrucure vs. Microstructure Pagraphs and sentences: The opening sentence of a paragraph states the guiding idea for that paragraph. Middle sentences expand on that fundamental notion. Often, the middle sentences provide detail and perspective that illuminate the guiding idea. The final sentence bring closure to the paragraph and permits transition to the next paragraph. Try to avoid one-sentence paragraphs, particularly if they do not relate to the previous thought. Such hanging thoughts can be avoided by making sure that any sentence—whether it begins a new paragraph or not—relates to the sentence that came before and leads naturally to the one that comes next. Discontinuity of structure is a clue to underlying confusion.
Exercise Data was normalised and produced significant results, indicating that ketamine will increase the heart rate of an isolated preparation consistently at 100µM. Confirming the findings of previous authors we decided to dissect a possible mechanism for this action. Interestingly, the application of ketamine together with m-AChR and β-adrenoceptor antagonists produced results which are to date undocumented to the best of our knowledge. The Internet Journal of Cardiology. 2008. Volume 6 Number 1
Exercise Data was normalised and produced significant results, indicating that ketamine will increase the heart rate of an isolated preparation consistently at 100µM. Confirming the findings of previous authors we decided to dissect a possible mechanism for this action. Interestingly, the application of ketamine together with m-AChR and β-adrenoceptor antagonists produced results which are to date undocumented to the best of our knowledge. Using a normal transformation of the data, we confirmed previous findingsR that 100 µM/time of ketamine will significantly increase The application of the heart rate in an isolated preparation. ketamine together with m-AChR and β-adrenoceptor antagonists produced results that suggest a possible mechanism for this action. The Internet Journal of Cardiology. 2008. Volume 6 Number 1
Some specific techniques • Dealing with adjectives • Turning a sentence around • The seven deadly sins
Adjectives • Don’t throw them away; justify them. • Show, don’t tell. • Mix with others, for a balanced diet • Most adjectives can be omitted. • Writing is stronger without than with
Adjective checklist • Does it really qualify the noun? • Big whales • Greasy spoon • Professional driver • Does it repeat what is already known? • The presumptive candidate • The crusty curmudgeon • The prim schoolmarm • Is it a cliché? • Greased lightning • Untimely death • Ample proof
Counting adjectives Undoubtedly the most drastically difficult aspect of the major portion of the intermediate study is the strong component that takes its particular example from previous studies. Without continuous attention to the myriad and complicated details with which the study was usually conducted, the investigators would be at a total loss to effectively understand the tortuous intricacies of the results
Counting adjectives Undoubtedly The most drastically difficult aspect of the major portion of the intermediate study is the strong component that takes its particular example from previous studies. Without continuous attention to the myriad and complicated details with which the study was usually conducted, the investigators would be at a total loss to effectively understand the tortuous intricacies of the results
Counting adjectives Undoubtedly The most drastically difficult aspect of the major portion of the intermediate study is the strong component that takes its particular example from previous studies. Without continuous attention to the myriad and complicated details with which the study was usually conducted, the investigators would be at a total loss to effectively understand the tortuous intricacies of the results
Counting adjectives Undoubtedly The most drastically difficult aspect of the major portion of the intermediate study is the strong component that takes its particular example from previous studies. Without continuous attention to the myriad and complicated details with which the study was usually conducted, the investigators would be at a total loss to effectively understand the tortuous intricacies of the results
Counting adjectives Undoubtedly The most drastically difficult aspect of the major portion of the intermediate study is the strong component that takes its particular example from previous studies. Without continuous attention to the myriad and complicated details with which the study was usually conducted, the investigators would be at a total loss to effectively understand the tortuous intricacies of the results
Counting adjectives Undoubtedly The most drastically difficult aspect of the major portion of the intermediate study is the strong component that takes its particular example from previous studies. Without continuous attention to the myriad and complicated details with which the study was usually conducted, the investigators would be at a total loss to effectively understand the tortuous intricacies of the results
Counting adjectives Undoubtedly The most drastically difficult aspect of the major portion of the intermediate study is the strong component that takes its particular example from previous studies. Without continuous attention to the myriad and complicated details with which the study was usually conducted, the investigators would be at a total loss to effectively understand the tortuous intricacies of the results