220 likes | 436 Views
RNA 的生物合成. Biosynthesis of RNA. 1.Concept of RNA biosynthesis. Transcription is the synthesis of a single- stranded RNA from DNA template. Transcription is asymmetry. RNA synthesis occurs in the 5’ 3’ direction. The transmission of the genetic infor-mations is from DNA to RNA.
E N D
RNA 的生物合成 Biosynthesis ofRNA
1.Concept of RNA biosynthesis • Transcription is the synthesis of a single- stranded RNA from DNA template. Transcription is asymmetry. • RNA synthesis occurs in the 5’3’ direction. • The transmission of the genetic infor-mations is from DNA to RNA.
coding strand* positive strand Crick strand antisense strand 3’ 5’ GTAC CATG 3’ 5’ GUAC 3’ sense strand 5’ Watson strand new RNA strand negative strand template strand*
transcriptional template template 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ 5’ 3’ It is the fragments of gDNA. It is only one of double-strand DNA, therefore, transcription is asymmetric.
RNA polymerase in E.coli molecular weight:480kd consists of 2’ 3. Enzymes in RNA biosynthesis The 2’ complex is core enzyme in RNA polymerase The 2’ complex isholoenzyme of RNA polymerase
determines which genes are transcribed catalytic site ’ binds DNA template recognizes transcription initiation site The function of subunits of RNA polymerase in E. coli
RNA polymeras in eukaryote variety transcripts respond to amanitin Ⅰ 45s-rRNAresistant (28S, 18S, 5.8S) Ⅱ* hnRNA(mRNA)very sensitive Ⅲ 5s-rRNA midding tRNA,snRNA sensitive
3’ • There is some sequence, which is recognized and bound by RNA polymerase, on 5’ end of transcriptional genes. • characters of the sequence • There are many A-T pairs • There are some consensus • sequence gene + ’ 5’ 4. Promotor
The binding region 5’ gene termination signal 5’ -50 -40 -30 -20 -10 1 10 transcribed initiation site promoter site
In prokaryotes promoter 40-80bp 5’ 2 3 1 -50 -40 -30 -20 -10 1 10 gene transcribed initiation site TATAATPu ATATTAPy TTGACA AACTGT Binding site Pribnow box Recognition site
In eukaryotes promoter 5’ -50 -40 -30 -20 -10 1 10 gene GC box CAAT box TATA box Hogness box
5. terminator DNA 5’…GCCGCCAGTTCGGCTGGCGGCATTTT… 3’ RNA 5’…GCCGCCAGUUCGGCUGGCGGCAUUUU…3’ C • The signals that terminates transcri-ption are localized in the gene 3’ end. • A simple termination signal is a GC- rich region that is a palindrome, followed by AT-rich sequence. • The RNA made from the DNA palindrome is self-complementary and so formed a internal hairpin structure followed by a few U bases. G U U G G AC C G C C G C UG G C G G C 5’ A U U U U-OH 3’
6. Process of RNA biosynthesis (1) initiation (2) elongation 1. initiation (3) termination 2. elongation
(3) termination Dependent upon factor RNA polymerase Promoter Terminator Gene 5’ 5’ c c c c c c c c c c new RNA
factor function: It can bind with polyC in RNA 3’end. It has activity of ATPase and helicase. It may denature short RNA-DNA hybrid double strands.
Independent to factor: The base sequence and transcript RNA secondary structure of rplL gene 3’ end in E. coli. TTGCAGCCTGAGAAATCAGGCTGATGGCTGGTGACTTTTTAGTCACCAGCCTTTTT or UUUUU UUUUU
transcription termination for independent to factor RNA polymerase coding strand 5’ 5’ 5’ template strand new RNA transcript
modification and termination of transcription about eukaryotegene RNA polymerase coding strand 5’ AATAAA GTGTGT modification point TTATTT CACACA 5’ 5’ GUGUGU AAUAAA template strand new RNA strand AAA AAA polyA tail 5’ AAA AAA
Polyribosomes (or polysomes) • High speed • High efficiency