egenskaber ved sorter af v rbyg til kologisk dyrkning bar of
Download
Skip this Video
Download Presentation
Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF

Loading in 2 Seconds...

play fullscreen
1 / 13

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF - PowerPoint PPT Presentation


  • 100 Views
  • Uploaded on

Sortsblandinger. Ukrudt. Sortsforsøg. Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF. Sygdomskomplekser. Matemati k og statistik. Mole kylære markører. N æringsstofoptagelse. Sortsblandinger. Ukrudt. Sortsforsøg.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF' - fai


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
egenskaber ved sorter af v rbyg til kologisk dyrkning bar of
Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbyg til økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse

egenskaber ved sorter af v rbyg til kologisk dyrkning bar of1
Sortsblandinger

Ukrudt

Sortsforsøg

Egenskaber ved sorter af vårbygtil økologisk dyrkning – BAR-OF

Sygdomskomplekser

Matematik og statistik

Molekylære markører

Næringsstofoptagelse

hvorfor dna mark rer i bar of
Hvorfor DNA markører i BAR-OF?
  • Til at beskrive genetisk diversitet mellem linierne/sorterne
  • Til at sammenligne molekylære markører og morfologiske egenskaber til sortsbestemmelse
  • Til at beskrive forandringer i sammensætning af sortsblandinger gennem forsøgstidsrummet
  • Til at lokalisere gener for egenskaber med betydning i økologisk landbrug på kromosomfragmenter
hvilke dna mark rer bliver brugt
Eksempel:

TGTGGGGCCACAAAACGTATAGATCAAAGTAATAATAATATTGATTAAATG

ATATATATATATATATATATATATATATATATATAT

CTAGAAGTTGTAGAAGACTAGCTAGAACGTACG

Hvilke DNA markører bliver brugt?
  • Mikrosatelliter= SSR (Simple Sequence Repeats)
fordeling af mark rgrupper
Fordeling af markørgrupper

96 liniermed 75 mikrosatelliter

genetisk distance
Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter

genetisk distance1
Genetisk distance

MDS baseret på 96 byg-linier og 75 mikrosatelliter

eco tilling procedure
Genspecifikke primer(2 forskellige farver)

Tst + Std

Std

+ CEL I

Eco-TILLING procedure

Pooling

DNAisolation

Standard(Std)

Tester(Tst)

PCR reaktion

Denaturering

Renaturering

ad