Download
Skip this Video
1 / 22
Smith Algorithm - PowerPoint PPT Presentation
- By eros
- Follow User
- 104 Views
- Uploaded on
Smith Algorithm. Experiments with a very fast substring search algorithm, SMITH P.D., Software - Practice & Experience 21(10), 1991, pp. 1065-1074. . Adviser: R. C. T. Lee Speaker: C. W. Cheng National Chi Nan University. Problem Definition.
Download Presentation 
An Image/Link below is provided (as is) to download presentation
PowerPoint Slideshow about 'Smith Algorithm' - eros
An Image/Link below is provided (as is) to download presentation
Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.
While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.
- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Smith Algorithm
Experiments with a very fast substring search algorithm, SMITH P.D., Software - Practice & Experience 21(10), 1991, pp. 1065-1074.
Adviser: R. C. T. Lee
Speaker: C. W. Cheng
National Chi Nan University
Problem Definition
Input: a text string T with length n and a pattern string P with length m.
Output: all occurrences of P in T.
Definition
- Ts: the first character of a string T aligns to a pattern P.
- Pl : the first character of a pattern P aligns to a string T.
- Tj : the character of the jth position of a string T.
- Pi : the character of the ith position of a pattern P.
- Pf : the last character of a pattern P.
- n :The length of T.
- m : The length of P.
Rule 2-2: 1-Suffix Rule (A Special Version of Rule 2)
- Consider the 1-suffix x. We may apply Rule 2-2 now.
Introduction
- takes the maximum of the Horspool shift function and the Quick Search shift function.
- uses Rule 2-2: 1-Suffix Rule
Smith Algorithm
- This algorithm is almost the same as Quick Search Algorithm except the last character of the window is also considered.
If this will induce a better movement than the Quick Search Algorithm. This is used; otherwise the Quick Search is used.
Example
- Text string T=GCGCAGAGAGTAGAGAGTACG
- Pattern string
P=CAGAGAG
hpBC[A]=1, qsBC[G]=1, shift=1
mismatch
Example
- Text string T=GCGCAGAGAGTAGAGAGTACG
- Pattern string
P=CAGAGAG
hpBC[G]=2, qsBC[A]=2, shift=2
mismatch
Example
- Text string T=GCGCAGAGAGTAGAGAGTACG
- Pattern string
P=CAGAGAG
hpBC[G]=2, qsBC[T]=8, shift=8
exact match
Example
- Text string T=GCGCAGAGAGTAGAGAGTACG
- Pattern string
P=CAGAGAG
hpBC[T]=7, qsBC[A]=2, shift=7
mismatch
Time complexity
- preprocessing phase in O(m+ σ) time and O(σ) space complexity, σ is the number of alphabets in pattern.
- searching phase in O(mn) time complexity.
Reference
[KMP77] Fast pattern matching in strings, D. E. Knuth, J. H. Morris, Jr and V. B. Pratt, SIAM J. Computing, 6,
1977, pp. 323–350.
[BM77] A fast string search algorithm, R. S. Boyer and J. S. Moore, Comm. ACM, 20, 1977, pp. 762–772.
[S90] A very fast substring search algorithm, D. M. Sunday, Comm. ACM, 33, 1990, pp. 132–142.
[RR89] The Rand MH Message Handling system: User’s Manual (UCIVersion), M. T. Rose and J. L. Romine,
University of California, Irvine, 1989.
[S82] A comparison of three string matching algorithms, G. De V. Smith, Software—Practice and Experience,12,
1982, pp. 57–66.
[HS91] Fast string searching, HUME A. and SUNDAY D.M. , Software - Practice & Experience 21(11), 1991, pp.
1221-1248.
[S94] String Searching Algorithms , Stephen, G.A., World Scientific, 1994.
[ZT87] On improving the average case of the Boyer-Moore string matching algorithm, ZHU, R.F. and
TAKAOKA, T., Journal of Information Processing 10(3) , 1987, pp. 173-177 .
[R92] Tuning the Boyer-Moore-Horspool string searching algorithm, RAITA T., Software - Practice & Experience,
22(10) , 1992, pp. 879-884.
[S94] On tuning the Boyer-Moore-Horspool string searching algorithms, SMITH, P.D., Software - Practice &
Experience, 24(4) , 1994, pp. 435-436.
[BR92] Average running time of the Boyer-Moore-Horspool algorithm, BAEZA-YATES, R.A., RÉGNIER, M.,
Theoretical Computer Science 92(1) , 1992, pp. 19-31.
[H80] Practical fast searching in strings, HORSPOOL R.N., Software - Practice & Experience, 10(6) , 1980, pp.
501-506.
[L95] Experimental results on string matching algorithms, LECROQ, T., Software - Practice & Experience 25(7) ,
1995, pp. 727-765.
