slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
The value of polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas isolated by laser capture m PowerPoint Presentation
Download Presentation
The value of polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas isolated by laser capture m

Loading in 2 Seconds...

play fullscreen
1 / 32

The value of polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas isolated by laser capture m - PowerPoint PPT Presentation


  • 288 Views
  • Uploaded on

The value of polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas isolated by laser capture microdissection

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'The value of polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas isolated by laser capture m' - emily


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

The value of polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas isolated by laser capture microdissection

ERIC SELVA*, VERONIQUE HOFMAN*$, FREDERICK BERTO*, SANDRA MUSSO$, LAURENT CASTILLO%, JOSE SANTINI%, PIERRE DELLAMONICA# AND PAUL HOFMAN* $

*INSERM 02-15, IFR 50, $Department of Pathology, %Department of Otorhinolaryngology, and #Department of Infectious Disease, University of Nice, Nice, France

Pathology(February 2004)36(1), pp. 77-81

introduction
Introduction

Mycobacterium tuberculosis in 2004

High infection

Drug resistant

Methods for detecting mycobacteria

Cultural identification

Ziehl-Neelsen(ZN)stain

PCR

Ile de France

Provence Alpes Côte d’Azur

introduction3
Introduction

Cultural identification

Standard method

Antibiotic sensitivity

Fresh specimen

Take up to 6 weeks

Ziehl-Neelsen(ZN)stain

Acid-fast bacilli

Not sensitive

Not identification species

introduction4
Introduction

Polymerase chain reaction(PCR)

Perform rapidly

High sensitivity

High specificity

>20μm in thickness

False positive

False negative

introduction5
Introduction

LCM ┼ PCR on FFPE

Increase efficiency

Overcome problem

FFPE

Formalin fixed paraffin embedded

materials
Materials

Lymph nodes from 49 case of inflammatory necrotizing granuloma

Department of pathology of Pasteur Hospital, University of Nice, France

1990 – 1998

methods
Methods

Laser capture microdissection

5μm tissue section

Deparaffinised and H&E stain

Microdissect using LCM microscope(PixCell Ⅱ, Arcturus Engineering, Alphelys, Paris, France)

DNA extraction

Clean with xylene

methods11
Methods

Whole section DNA extraction(1)

10 whole cross 5μm tissue sections

Deparaffinised by 1mL xylene, 20 minutes, 65℃, then 14000 rpm, 2 minutes, remove supernatant, twice

Washing 1mL 100%ethanol, 5 minutes, then 14000 rpm, 5 minutes, twice

Dried in a speed vacuum

methods12
Methods

Whole section DNA extraction(2)

Digestion buffer:

Distilled water

Proteinase K;100 μg/ μl;Sigma, Paris

Tris HCl;20mM;pH8.0

EDTA;20mM;Sigma

SDS;2%

Digestion 72 hours, 55℃

methods13
Methods

Whole section DNA extraction(3)

14000 rpm, 5 minutes

The supernatant = template for PCR

DNA concentration and purity:

Absorbency at 260 and 280 λ(Ultraspec 2000, USA)

methods14
Methods

PCR(1)

1μl DNA template;50mM KCl;10mM Tris HCl, pH8.3;dH2O;1.5mM MgCl2;dNTPs(200μM;Invitrogen, Paris, France);primer 1;primer 2;Taq Polymerase(1.25U; Invitrogen);final 50 μl

methods15
Methods

PCR(2)

Sequence of primer :

Primer 1(IS6110 5’):

5’– 3’:CCTGCGAGCGTAGGCGTCGG

Primer 2(IS6110 3’):

5’– 3’:CTCGTCCAGCGCCGCTTCGG

16S ribosomal RNA gene of M. tuberculosis

methods16
Methods

PCR(3)

Condition for PCR :

94℃ 5 minutes

67℃ 1 minutes

72℃ 40 seconds

35 cycles

Perkin – Elmer Thermal Cycler;CA, USA

methods17
Methods

Electrophoresis

8μl PCR product

2μl bromophenol blue(Ficoll)

1.5% agarose, ethidium bromide – stained gel

135 V

30 minutes

methods18
Methods

DNA isolation control:

Amplification of β-actin gene

β-actin 5’:3’– AGCGGGAAATCGTGCGTG

β-actin 3’:5’– CAGGGTACATGGTGGTGC

Invitrogen, Paris, France

methods19
Methods

PCR control:

5 cases of sarcoidosis

5 cases of lymph nodes from HIV patients who presented with atypical mycobacteriosis(with positive culture for M. avium intracellulare)

Paraffin block without tissue

results
Results

PCR from microdissected granulomas and correlation with PCR from whole sections(1)

results22
Results

PCR from microdissected granulomas and correlation with PCR from whole sections (2)

※4 cases were negative both

※The signal obtained from microdissected granulomas was weaker than the signal obtained from whole sections

※All negative controls were negative both

※The latter case had been embedded more than 8 years

results23
Results

Correlation of PCR from microdissected granulomas with acid fast stained tissue

results24
Results

Correlation of PCR from microdissected granulomas with culture

discussion
Discussion

※Infectious diseases => Granulomas

※Detection of granuloma => Diagnosis of Tuberculosis

※Determination the causative agent => Special stain

*Sensitivity

*Specificity

discussion26
Discussion

※Cultural identification:

*Mycobacterial infection may not have been clinically suspected and specimens not obtained for culture.

※Molecular diagnosis of M. tuberculosis =>PCR(whole section)

※ PCR positive rate=>DNA quantity

※ PCR false negative=>2%~19% (whole section)

discussion27
Discussion

※The PCR performed from whole sections may present some disadvantages:

*An excessive material-consuming method on small specimens.

*Increasing the effect of tissue inhibitors or contamination.

※Lesion <=> PCR result

*Relatively low amount of specimen

*PCR-based analysis for amplification

discussion28
Discussion

※LCM:

discussion29
Discussion

※PCR detection of M. tuberculosis:

*Sensitivity=>92%

*Specificity=>100%

※LCM +PCR :

*Useful on small specimen

*Reduce false positive due to contamination

※Successful confirmation of M. tuberculosis

* (×) Tissue DNA

* (o) Digestion for obtain M. tuberculosis DNA

discussion30
Discussion

IS6110 :

CCT GCG AGC GTA GGC GTC GG

CTC GTC CAG CGC CGC TTC GG

TB11/12:

ACC AAC GAT GGT GTG TCC AT

CTT GTC GAA CCG CAT ACC CT

TB2A/2B:

GAG ATC GAG GTC GAG GAT CC

AGC TGC AGC CCA AAG GTG TT