1 / 34

DNA Structure and Protein synthesis

DNA Structure and Protein synthesis. What is DNA?. DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making proteins Every nucleated cell in your body contains DNA.

elfriedae
Download Presentation

DNA Structure and Protein synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Structure and Protein synthesis

  2. What is DNA? • DNA = deoxyribonucleic acid • Chromosomes are made of DNA • It carries genetic information: controls the activities of cells by providing instructions for making proteins • Every nucleated cell in your body contains DNA.

  3. Alfred Hersey and Martha Chase Experiment (1952) • protein coat and the DNA of bacteriophage (virus that attacks bacteria) were marked using radioactive sulphur (35S) and phosphorus (32P), • bacteriophage DNA (radioactive) moved into the bacterial cells and directed them to produce new bacteriophages (radioactive) • protein coating(radioactive) was left outside the cell, new bacteriophages were not radioactive • conclusion: DNA, not protein, carries genetic information

  4. Alfred Hersey and Martha Chase Experiment (1952)

  5. Earlier work by a biochemist P.A. Levine • DNA was made up of nucleotides. • Each nucleotide is made up of three parts. 1) A sugar called deoxyribose 2) a phosphate group (phosphoric acid) 3) one of the four nitrogen containing bases (adenine, guanine, thymine and cytosine – A, G, T, C) • Levine found that each nitrogen base is attached to a sugar, and each sugar is attached to a phosphate group to form a single nucleotide. • Each nucleotide is named for the base it contains.

  6. Nucleotide

  7. Nitrogen Bases

  8. Other studies: • nucleotides are joined together to form long chains. • Erwin Chargaff: equal number of adenine and thymine as well as guanine and cytosine. (#A = #T, #G = #C)

  9. Nucleotide Pairs

  10. Discovering the Double Helix-Information scientists knew: • DNA is made up of nucleotides • Nucleotides are linked together in a string. • In each DNA molecule there is an equal number of A – T and an equal number of G-C • If the nucleotides are strung in a straight line, a typical DNA molecule would be over 1 meter long. Somehow it must be compressed.

  11. Rosalind Franklin (1953) • British crystallographer, was able to photograph molecules using x-rays. (X-ray diffraction) • These patterns indicated DNA was like a coil. The DNA molecule had a constant diameter of 2 nm. It did not get wider or narrower in some parts of the molecule.

  12. James Watson and Francis Crick • came up with the current model for DNA. They compared it to a spiral staircase. • They called this shape a double helix. They also determined that nitrogen bases were always paired in the same manner. These paired nitrogen bases are called complementary base pairs. (A with T, G with C)

  13. A and T by 2 H- bondsG and C by 3 H-bonds

  14. Links • DNA Structure • http://www.youtube.com/watch?v=qy8dk5iS1f0&feature=related • http://www.youtube.com/watch?v=l-hrLs03KjY • DNA Replication • http://www.youtube.com/watch?v=hfZ8o9D1tus&feature=related • http://www.youtube.com/watch?v=z685FFqmrpo&feature=related • http://www.youtube.com/watch?v=AGUuX4PGlCc&feature=related • RNA synthesis • http://www.youtube.com/watch?v=UXJzNI_t_r4 • RNA to Protein • http://www.youtube.com/watch?v=NJxobgkPEAo • http://www.youtube.com/watch?v=983lhh20rGY

  15. DNA Sequencing • Unique genetic information is determined by the sequence of nucleotides. • A sequence of A-T-C-G-G-A carries different information from the sequence C-A-G-T-T-A. The closer the relationship between two organisms, the greater the similarities in their DNA sequences. • The order of base pairs in a DNA molecule makes up the genetic code of an organism to produce proteins.

  16. Predicting the opposite base sequence • What would be the opposite strand of DNA if the sequence was? • A-T-C-G-A-G-T-T-G

  17. A-T-C-G-A-G-T-T-G • Opposite strand: T-A-G-C-T-C-A-A-C

  18. What is DNA responsible for? • DNA determines how amino acids are strung together and how proteins are made. The sequence of amino acids is determined by the sequence of NUCLEOTIDES in the DNA. • A gene is a segment of DNA that controls the production of a protein. • The genetic information on DNA must be transcribed to RNA to make proteins.

  19. Protein

  20. Polypeptide Chain • Proteins are made up of 20 kinds of amino acids. For each protein, amino acids are linked together in a certain order. • Linked amino acids form long chains called polypeptides, and two or more polypeptides are joined to make a particular protein. • Examples of protein: Keratin - nails and hair Insulin – hormone, controls sugar levels. Hemoglobin -in red blood cells Enzymes

  21. Genetic Information must be transcribed from DNA to RNA • RNA= ribonucleic acid • - contains ribose sugar (one more oxygen than in DNA) • - single stranded, • - uracil replaces thymine, adenine pairs with uracil, guanine pairs with cytosine (A-U,G-C) • - found in the nucleus and the cytoplasm of a cell

  22. Three Types of RNA • 1) messenger RNA (mRNA): acts as a messenger that carries the DNA information from the nucleus to the ribosomes in the cytoplasm • 2) transfer RNA (tRNA): delivers amino acids to ribosomes • 3) ribosomal RNA (rRNA): Binds with proteins to form the ribosomes

  23. Summary • 3 nitrogen bases (3 nucleotides) on DNA (ex. GAA)  3 nitrogen bases (3 nucleotides) or a codon on RNA (ex. CUU) 1 amino acid (ex. Leucine)  20 different types of amino acids  a polypeptide chain  many polypeptide chains protein

  24. Steps from DNA to Protein: • 1. An enzyme binds to DNA and unzips the two strands. DNA opens like a zipper. • 2. Transcription: Another enzyme attaches nucleotides on one of the two open DNA strands as a template to make an mRNA strand. • Ex) DNA Strand • GCGCGTATGCATTAGTCGTCACGTACATGGTACTGATCA • RNA Strand?

  25. RNA sequence • Ex) DNA Strand • GCGCGTATGCATTAGTCGTCACGTACAT GGTACTGATCA • RNA Strand? (U instead of T) • CGCGCAUACGUAAUCAGCAGUGCAUGUA CCAUGACUAGU same as the opposite DNA strand (nontemplate strand)

  26. Steps from DNA to Protein: • 3. The mRNA detaches from the DNA template and moves out of the nucleus. It travels to the ribosomes in the cytoplasm.

  27. Steps from DNA to Protein • 4. Translation: A ribosome attaches to the mRNA. Each set of 3 bases, known as a CODON, codes for an amino acid. tRNA brings an amino acid to the ribosome according to the codon on the RNA. Amino acids make up a polypeptide chain. • 5. The polypeptide chain leaves the ribosome and joins with other polypeptide chains. They fold and form a protein.

  28. Codons on RNA • Start codon - AUG (Methionine) This sequence indicates the FIRST amino acid in the chain that will grow to be a protein. • Stop Codon (UAA, UAG, UGA)– indicates that no more amino acids should be added and a particular protein is complete.

  29. The RNA Genetic Code

  30. Q1. What amino acid does this 3 base sequence (codon) code for? • 1) ACU: threonine • 2) CGA: arginine

  31. Q2. What codon(s) code for • 1)glycine? GGU, GGC, GGA, GGG 2)leucine? UUA, UUG, CUU, CUC, CUA, CUG

More Related