jgi timeline n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
JGI Timeline PowerPoint Presentation
Download Presentation
JGI Timeline

Loading in 2 Seconds...

play fullscreen
1 / 37

JGI Timeline - PowerPoint PPT Presentation


  • 125 Views
  • Uploaded on

JGI Timeline. Human Genome Program Officially Launched. Human Genome Program Officially Ended. JGI. April 2003. 1990. 1997. 19. 5. 16. Joint Genome Institute …………………. (JGI). Non Traditional User Facility. The JGI Post Human Genome Project Community Sequencing Program

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'JGI Timeline' - eilis


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
jgi timeline
JGI Timeline

Human Genome Program

Officially Launched

Human Genome Program

Officially Ended

JGI

April 2003

1990

1997

19

5

16

Joint Genome Institute ………………….(JGI)

Non Traditional User Facility

slide2
The JGI Post Human Genome Project

Community Sequencing Program

(CSP)

Microbial Community Genomics

slide4

Overview

The Community Sequencing Program (CSP)

To provide the scientific community through a peer reviewed process access to high throughput sequencing at the JGI.

slide5

User Guide > How to Propose a Project

What types of projects will the JGI/CSP accept?

A wide range of projects. Ultimately, the most important factor in determining if a project will be accepted is its scientific merit.

slide6

Proposals & Peer Review Process

General Scientific Users Proposals

Designated Lab

Director

Proposal

Study

Panel

Scientific

Advisory

Committee

Users

JGI Director

Sequence

Allocation

slide7

What can researchers get from the CSP program?

The deliverables can range from raw sequence traces to well-annotated assembled genomes depending on the request in the proposal.

scientific support for approved projects

Interactions of the JGI and Scientific Users with Approved Sequencing Proposals

Scientific Support for Approved Projects

Production

Sequencing

Users

Scientific

Support

Group

SSG

Informatic

Analysis

Of

Sequence

scientific support for approved projects1

Interactions of the JGI and Scientific Users with Approved Sequencing Proposals

Scientific Support for Approved Projects

Production

Sequencing

DOE

Gov Agencies

Scientific

Support

Group

SSG

GTL, Microbe

CSP

(EPA,USDA, NSF)

Informatic

Analysis

Of

Sequence

slide10

DOE

Production Sequencing

Informatics

JGI Science Programs

slide11

DOE+CSP+Gov A

Scientific Support Group

Informatics

Production Sequencing

JGI Science Programs

slide12

Sequence Based Science at the JGI

    • Gene Regulatory Vocabulary of Animals
    • Studies of Body Plan Evolution
    • Microbial Community Genomics
slide13
< 1% of microbes are culturable
  • Many unculturables live in interdependent consortia of considerable diversity
  • Aim: to recover genome-scale sequences and reveal metabolic capabilities
  • What is the structure of natural microbial populations? What is a microbial species? Can we harness their metabolic capabilities
what enviroments to study
What Enviroments to Study?
  • Ones with minimal microbial complexity
iron mountain
Iron Mountain

JillBanfield

Gene Tyson

Phil Hugenholtz

UC Berkeley Geology

Jill Banfield et al.

UC Berkeley

iron mountain1
Iron Mountain

Superfund site

Discharging >1 ton of toxic metals/day

(pH <1)

FeS2

slide18

=

=

=

=====

===

==

=

Enviromental Sample

Purify High Molecular Weight DNA

Fosmid Library

Construction

Shotgun Library

Construction

=====

===

==

=

=====

===

==

=

=====

===

==

=

Fosmid Insert

End Sequencing

=

DNA

Sequencing

Assembly

Annotation

slide19

Shotgun Library

Construction

Shotgun Library

Construction

=

=

=====

===

==

=

=====

===

==

=

=====

===

==

=

=====

===

==

=

=

=

=

=====

===

==

=

Enviromental Sample

Purify High Molecular Weight DNA

When possible culture isolates

Fosmid Library

Construction

=====

===

==

=

Fosmid Insert

End Sequencing

DNA

Sequencing

Assembly

Annotation

?

=

iron mtn whole metagenome shotgun gc content separates into two components
Iron Mtn “whole metagenome shotgun” GC content separates into two components

bacteria

Reverse read average G+C

archaea

Forward read average G+C

iron mountain whole metagenome shotgun gc and depth distributions
Iron Mountain “whole metagenome shotgun” GC and depth distributions

0.55

Read average G+C

0.38

Read depth

Lepto III

3

10

Lepto II

Bacterial

slide22

0.55

Read average G+C

0.38

Read depth

Lepto III

3

10

Lepto II

Bacterial

Archaeal

Fer 1 (cultured and sequenced )

G-plasma

Fer 2

3

10

slide23

0.55

Read average G+C

0.38

Stoichiometry

Read depth

Lepto III (1X)

3

10

Lepto II (3X)

Bacterial

Archaeal

Fer 1 (1X)

G-plasma (1X)

Fer 2 (3X)

3

10

slide24

0.55

Read average G+C

0.38

Lepto III

3

10

Lepto II

Other sampled genomes at low depth (including eukaryotes) 15% of reads

Bacterial

Archaeal

Fer 1

G-plasma

Fer 2

3

10

similarity to fer1 isolate to sequence in community
Similarity to Fer1(isolate) to Sequence in Community

78.2%

64.9%

Mixed Community Reads

98-100%

Fer2

Fer1

G plasma

Number of reads

.50

.60

.70

.80

.90

1.

%id to cultivated Fer1 isolate

conclusions so far
Conclusions So Far
  • The stochiometry of organisms encouraging for the assembly of individual genomes
  • Assemblies support 16S studies suggesting limited diversity
  • Isolated Fer1 genome sequences matches genome in environmental sample
how do you know you ve done it right check pair ends against scaffold
How do you know you’ve done it right?Check pair ends against scaffold

How do we know that our assembly is correct?

At the gross level: check pairs (expect few % due to failing/chimeric clones)

Align all reads back against assembled scaffolds

scaffolds end where there is no clone coverage in 3kb plasmids

Identifies potentially repetitive areas and/or rearrangements

fer2 vs fer1 shows local synteny
Fer2 vs. fer1 shows local synteny
  • Fer1 and
  • Fer2 have avg. nt identity of 78%

Fer2 gene on contig

Fer1 gene on contig

what does it mean to assemble a community genome
What does it mean to assemble a community genome?

Sample derived from millions of genomes.

?

  • What is a “species” in the enviroment?
  • Members of the same species
  • significantly different (many lineages survive and diverge)
  • highly similar (selective sweeps)
what does it mean to assemble a community genome1
What does it mean to assemble a community genome?

Lepto II : 1 nucleotide variation / 3,000 bp

Fer II: 2.2 nucleotide variation / 100 bp

5 reads of the same sequence from 5 different members of the same species ferii
5 Reads of the Same Sequence from 5 Different Members of the Same Species (FerII)

1

1

2

2

4

4

5

5

  • CONSENSUS 130953 gtttatattaaatccattgatttctaagcttccggttcttcttccgtataatggagattt 131012
  • XYG46314.b1 162 A.......C........................A...........A.............. 103
  • XYG44123.b1 673 A.......C........................A...........A.............. 732
  • XYG44918.b1 48 A.......C........................A........... 4
  • XYG13291.g3 2 .......... 11
  • XYG40116.g1 192 ......G..................................................... 133
  • XYG3051.b2 396 ......G..................................................... 455
  • CONSENSUS 131013 atagcttaataattcatcctccatcatacttatgcttgaacctgataatattatgtatag 131072
  • XYG46314.b1 102 ............................................................ 43
  • XYG44123.b1 733 ............................................................ 792
  • XYG13291.g3 12 ............................................................ 71
  • XYG40116.g1 132 ...A........................................................ 73
  • XYG3051.b2 456 ...A........................................................ 515
  • CONSENSUS 131073 ccttgtagtatccattaattcatcaaatattttctgcattatagatataataccatggtt 131132
  • XYG46314.b1 42 .......................................... 1
  • XYG44123.b1 793 ........................ 816
  • XYG13291.g3 72 ............................................................ 131
  • XYG40116.g1 72 T............G....C....................A.................... 13
  • XYG3051.b2 516 T............G....C....................A.................... 575

1

1

3

3

two haplotypes among the 5 different members of the same species ferii
Two Haplotypes Among the 5 Different Members of the Same Species (FerII)

1

1

2

2

4

4

5

5

  • CONSENSUS 130953 gtttatattaaatccattgatttctaagcttccggttcttcttccgtataatggagattt 131012
  • XYG46314.b1 162 A.......C........................A...........A.............. 103
  • XYG44123.b1 673 A.......C........................A...........A.............. 732
  • XYG44918.b1 48 A.......C........................A........... 4
  • XYG13291.g3 2 .......... 11
  • XYG40116.g1 192 ......G..................................................... 133
  • XYG3051.b2 396 ......G..................................................... 455
  • CONSENSUS 131013 atagcttaataattcatcctccatcatacttatgcttgaacctgataatattatgtatag 131072
  • XYG46314.b1 102 ............................................................ 43
  • XYG44123.b1 733 ............................................................ 792
  • XYG13291.g3 12 ............................................................ 71
  • XYG40116.g1 132 ...A........................................................ 73
  • XYG3051.b2 456 ...A........................................................ 515
  • CONSENSUS 131073 ccttgtagtatccattaattcatcaaatattttctgcattatagatataataccatggtt 131132
  • XYG46314.b1 42 .......................................... 1
  • XYG44123.b1 793 ........................ 816
  • XYG13291.g3 72 ............................................................ 131
  • XYG40116.g1 72 T............G....C....................A.................... 13
  • XYG3051.b2 516 T............G....C....................A.................... 575

1

1

3

3

two haplotypes among the 5 different members of the same species fer ii
Two haplotypes Among the 5 Different Members of the Same Species (Fer II)

1

1

2

2

4

4

5

5

  • CONSENSUS 130953 gtttatattaaatccattgatttctaagcttccggttcttcttccgtataatggagattt 131012
  • XYG46314.b1 162 A.......C........................A...........A.............. 103
  • XYG44123.b1 673 A.......C........................A...........A.............. 732
  • XYG44918.b1 48 A.......C........................A........... 4
  • XYG13291.g3 2 .......... 11
  • XYG40116.g1 192 ......G..................................................... 133
  • XYG3051.b2 396 ......G..................................................... 455
  • CONSENSUS 131013 atagcttaataattcatcctccatcatacttatgcttgaacctgataatattatgtatag 131072
  • XYG46314.b1 102 ............................................................ 43
  • XYG44123.b1 733 ............................................................ 792
  • XYG13291.g3 12 ............................................................ 71
  • XYG40116.g1 132 ...A........................................................ 73
  • XYG3051.b2 456 ...A........................................................ 515
  • CONSENSUS 131073 ccttgtagtatccattaattcatcaaatattttctgcattatagatataataccatggtt 131132
  • XYG46314.b1 42 .......................................... 1
  • XYG44123.b1 793 ........................ 816
  • XYG13291.g3 72 ............................................................ 131
  • XYG40116.g1 72 T............G....C....................A.................... 13
  • XYG3051.b2 516 T............G....C....................A.................... 575

1

1

3

3

polymorphisms occur in blocks
Polymorphisms occur in blocks

% polymorphic sites

  • Long quiet regions separate highly variable segments
  • Variation is found in blocks of 5-10 genes

Local depth

ORFs

summary of iron mountain biofilm
Summary of Iron Mountain Biofilm
  • Limited number of predominant species present in biofilm the majority have never been cultured
  • Several lines of evidence suggest that we can assemble genomes of these organisms
  • Simplicity of community suggests removal of most variants by natural selection
  • Now studying the metabolic capabilities of microbes