fall 2014 hort6033 molecular plant b reeding n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Fall 2014 HORT6033 Molecular Plant B reeding PowerPoint Presentation
Download Presentation
Fall 2014 HORT6033 Molecular Plant B reeding

Loading in 2 Seconds...

play fullscreen
1 / 10

Fall 2014 HORT6033 Molecular Plant B reeding - PowerPoint PPT Presentation


  • 287 Views
  • Uploaded on

Fall 2014 HORT6033 Molecular Plant B reeding. Instructor: Ainong Shi. HORT6033 web site: http://comp.uark.edu/~ashi/MB. Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014). SNP SNP discovery by PCR Example Homework Question. Single Nucleotide Polymorphism (SNP).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

Fall 2014 HORT6033 Molecular Plant B reeding


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
    Presentation Transcript
    1. Fall 2014HORT6033Molecular Plant Breeding Instructor: Ainong Shi HORT6033 web site: http://comp.uark.edu/~ashi/MB

    2. Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014) • SNP • SNP discovery by PCR • Example • Homework • Question

    3. Single Nucleotide Polymorphism (SNP) • SNP: • A single nucleotide (A, T, C or G) mutation • Use: • genetic and genome mapping, • Association studies, • Genetic diversity analysis, and • Tagging important genes • Approach: • SNP discovery from PCR • SNP discovery from High throughput - Next generation sequencing (NGS) – RNA-Seq, RAD-Seq, GBS etc. (http://learn.genetics.utah.edu/content/pharma/snips/)

    4. SNPDiscovery Tool • There are dozens of tools for SNP discovery. We will talk below two: • BioEdit • Download: http://www.mbio.ncsu.edu/bioedit/page2.html • Manual: http://www.mbio.ncsu.edu/BioEdit/BioDoc.pdf • DNASTAR Lasergene Genomics Suite • Download free TRY IT version : http://www.dnastar.com/t-products-dnastar-lasergene-genomics.aspx and all use manuals can also be downloaded or viewed from the web site.

    5. SNPGenotyping • Single SNP genotyping assay: • Taqman – Life Technologies http://www.vetmed.ucdavis.edu/vme/taqmanservice/pdfs/SNP_Genotyping.pdf • KASP genotyping - LGC Genomics http://www.lgcgenomics.com/genotyping/kasp-genotyping-chemistry/how-does-kasp-work/ • Multiple SNP genotyping: • SNP chip – Illumina • Multiplex – Sequenom • SNP genotyping by next generation sequencing • Genotyping by sequencing (GBS) • (http://cbsu.tc.cornell.edu/lab/doc/GBS_Method_Overview1.pdf) • Restriction site associated DNA sequencing (RADseq) • (http://bfg.oxfordjournals.org/content/9/5-6/416.full.pdf+html)

    6. SNP Discovery by PCR AAGCTTGGTGCAATGACATTATACAATCAACAAAGAATAGAAAGGAGATAAAAAGCACTATCCAAATCCC --------------------------------------------------------------------- ---------------------------------------------------------------------- TCCATTTTCCTTTTTTTGATTATTCCAGCTACCAAGACAACCACTAGGGGCAGTCCTTTGCATTTTTCTG CTACTGCTTGACTCACATCTTGTAGTTCAAGCGGGCAATCTTCCTTTTGAAACACTTTTTTCTGCAACAA TTGGCAACTCTCTTCTGTTGTGAGGAATGGAAGAGAATAAGGATCAGTATGGTACTTGACTTGCTTACCC ACTTCTTCAAGTCGAGTTGTTACGACTATTCTGCTTCTAATTCCAACATCTGGAAAAGAAAGCCTTAAGT CATCCCATACCATACAATCCCACATATCATCCAATACAATGAGATATCTCTTTCCCATTAATTTTCTCCT CAACATGTCGGCAAGAACATCAACCGTAGCTCCATTGTCGTTGAAACCTGTAACTTGACTGAAAATATCT TGTAATAACTCTATCCGGTTATACGTTTGAGAAATGATGCACCATGCTCGAACATCAAAGCGAGAAACAA TAATGTCATTATTGTACAACTTTCTAGCAATTGTCGTTTTCCCTTGTCCTCCCATGCCTACAATTGGGAC AACGTCTAGCTCATTTGTACCTCTAGTCAGATAATCAATTAGTTCTTCTGCTTGTTTCTCAAAACCCACT ACCTCCTCATCAGTTACAAGATTGCTATGTCGATCCGGCAGATGTTTTAATGGAGCAGCCACATAGTGAG ---------------------------------------------------------------------- TTGGCTTAAAATAAGTTTTTTTTAACTTAAAATATGTTATTTTGAGTATTGACAAACAACTAAATAAGTC AAAAATCAGCTTTTAAGTCAGTTTGACCACGCTCTCTTAT Sw-5: AY007366 Tool: Primer-BLAST Primer Design Sw5-f1 AACCACTAGGGGCAGTCCTT Sw5-r1 CTCACTATGTGGCTGCTCCA(TGGAGCAGCCACATAGTGAG) PCR PCR Product Sequencing Multiple Sequence Alignment SNP Discovery SNP Validation SNP Genotyping

    7. SNP Discovery Using BioEdit • Download and Install BioEdithttp://www.mbio.ncsu.edu/bioedit/bioedit.html • Example data: Sw-5 of gene of tomato spotted wilt virus resistance http://comp.uark.edu/~ashi/MB/example/Sw-5/sw5.fasta • Run BioEdit and Find SNPs • Example – SNP discovery in Tomato http://comp.uark.edu/~ashi/MB/lecture/Shi_et_al_SNP-assay-tomato-disease-resistance-2009aps.ppt

    8. Fall 2014 HORT6033 Molecular Plant Breeding Lecture 4 (09/03/2014) • Homework • Download Tm-2 gene sequences from NCBI web site (GenBank), run BioEdit to find SNP markers for Tm-2 locus of tomato mosaic virus resistanc • Download Sw-5 gene sequences from GenBank and find SNP markers for Sw-5 alleles of spotted wilt virus resistance

    9. SNP Markers for Tm-2 locus in Tomato AF536199_tm-2 ----------------------------------------------------------------- TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT TGATCGACGTAGCCTCATTCAACTTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAACATTTACTCATTGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCAACCGTTAAGATATTATCAACATGTCGC CCTGTGCCAAAGGCGCTAAAGGTTCTGAAGCTCAGGTTTTTCAGTGATCCGAGTGAGCAAATAAACTTGT CATCCTATCCAAAAATTGTTAAGTTGCATTTGAATGTTGACAGAACAATAGCCTTGAACTCTGAAGCATT CCCTCCAAATATTATCAAGCTTACTCTTGTCTGCTTTATGGTAGACAGTTGTCTACTGGCAGTGCTTAAG ACATTACCCAAATTAAGAAAACTTAAAATGGTCATCTGCAAGTATAATGAAGAAAAGATGGCTCTCTCGG GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA ------------------------------------------------------------____------ AF536201_Tm2a ----------------------------------------------------------------- TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAATATTTACTCATTGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGATGTTATCAATATTTAGC CCTGTGCTTAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCGAGTGAACAAATAAAGTTGT CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCTTGAACTCTCAATCATT TCCTCCAAATCTCATCAAGCTTACTCTAGCCTACTTTAGTGTAGACCGTTATATACTGGCAGTACTTAAG ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGAAAAGATGGATCTCTCGG GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA -----------------------------------------------------___-------------- AF536200_Tm2 ----------------------------------------------------------------- TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAATATTTACTCATTGC ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGATGTTATCAATATTTAGC CCTGTGCTCAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCGAGTGAACAAATAAAGTTGT CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCTTGAACTCTCAATCATT TCCTCCAAATCTCATCAAGCTTACTCTAGCCAACTTTACGGTAGACCGTTATATACTGGCAGTACTTAAG ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGAAAAGATGGATCTCTCGG GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA -----------------------------------------____------------------------- Tool: Primer-BLAST Primer Design Tm2RS-f3 TGGAGGGGAATATTTGTGGA Tm2RS-r3 ACTTCAGACAACCCATTCGG (CCGAATGGGTTGTCTGAAGT) PCR PCR Product Sequencing Multiple Sequence Alignment SNP Discovery CAPS Marker Identification SNP Genotyping SNP Genotyping

    10. Reading • Varshneyet al. 2009. Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends in Biotechnology 27:522–530 (Linked) • Liu et al. 2012. An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Methods 8: 34(http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3495711/pdf/1746-4811-8-34.pdf) • Gaur et al. 2012. High-Throughput SNP Discovery and Genotyping for Constructing a Saturated Linkage Map of Chickpea (CicerarietinumL.). DNA Res 19 (5): 357-373 (http://dnaresearch.oxfordjournals.org/content/19/5/357.full) • Shi et al. 2011. Identification of molecular markers for Sw-5 gene of tomato spotted wilt virus resistance. American Journal of Biotechnology and Molecular Sciences (1): 8-16. [PDF] http://scihub.org/AJBMS/PDF/2011/1/AJBMS-1-1-8-16.pdf