480 likes | 688 Views
Respiratory Diagnostics. Brian J. Payne, DVM Carthage Veterinary Service, Ltd. The Presentation. The actual presentation given at AASV is based on actual case studies.
E N D
Respiratory Diagnostics Brian J. Payne, DVM Carthage Veterinary Service, Ltd.
The Presentation • The actual presentation given at AASV is based on actual case studies. • This PowerPoint presentation (based on PRRS diagnostics specifically) describes many of the laboratory tests that were utilized for these actual cases.
One more thing… It has been an enormous benefit for me in a clinical setting to understand each diagnostic test that I request so that I can better interpret the results. I hope this helps!
PRRS…Diagnostics • Serology • PRRSv • PRRS Viral Antigens • PRRS Antibodies • Tissue • PRRSv • Other • Semen PRRSv
PRRS…Serology • ELISA • IFA • PCR • RFLP • Genetic Sequencing • SVN
PRRS…Indirect ELISA • Enzyme-linked immunosorbent assay • Extremely high sensitivity ~100% • 99.5% specificity • Quick to run • Indirect method to determine antigen-specific PRRSv antibodies
• Enzyme-labeled anti-porcine conjugate •Serum sample with PRRSv/Viral antibodies • Antigen • Polymer substrate Indirect ELISA…Process
Indirect ELISA…Results • Bound enzyme allows visual detection • In-house tests usually (+) or (-) • In-lab tests utilize optical densities to give continuous range of numbers University of AZ, 1993
Indirect ELISA...Results • IDEXX HerdChek • Based on S/P ratio • sample/positive • Optical densities (continual range) • < 0.3 = Negative • 0.3-0.4 = Suspect • > 0.3999 = Positive
Indirect ELISA…Antibody Detection • PRRSv Ab detectable 9-13 days PI • Peak at 30-50 days • Rapid decline but still may be detectable in > 10 months (personal experience is > 2 years)
Indirect ELISA…Limitations • Allows evidence of exposure to PRRSv • However, no information on: • Length of exposure • Severity of infection • Which strain is present • Differentiation of vaccine and wild-type virus • Variability of immune responses within a given population
PRRS…IFA • Indirect fluorescent antibody • Specificity 99.5% • Sensitivity (based on laboratory variation) • Culture media • Protocols • Incubation time • Cell types • Technician skill and subjectivity of results • Lab PRRSv genetic sim. to wild-type PRRSv
• Fluorescein-labeled anti-porcine antibody • Serum with PRRSv Antibodies (IgG) • PRRSv (lab) infected cells • Polymer substrate IFA…The Process
IFA…The Results • Magnitude of Ab titer can be determined unlike ELISA Magar, R., 1993
IFA…The Results • < 1:20 or 16 = negative • 1:20 or 16 or greater = positive • Titer endpoints are subjectively determined, therefore variation
IFA…Antibody Detection • IgG against PRRSv detectable 7-11 days PI • Peak at 30-50 days • Rapid decline but still may be detectable in 4-6 months
PRRS…PCR • Polymerase Chain Reaction • In vitro amplification of DNA • RNA of virus extracted from sample • Reverse transcriptase (RNA to DNA) • PCR amplifies DNA • Target most conserved genes • ORF 6 and ORF 7
A C T G PCR…Process Annealing DNA Heat Denaturing Primers and Cooling Taq + Nucleotides Reverse Transcriptase 30 Cycles Complementary Strands RNA
PCR…The Process After 30 cycles, 1000’s of replicates Gel Electrophoresis (Colorimetric, Radioactive, Fluorometric) (+) (-)
PCR…Adv / DisAdv • Rapid turnaround (RT-PCR) - 1-3 days • High sensitivity and specificity • Detects Ag…no need to wait for immune system response • Detection determined by correlation b/w primers and PRRSv • Not indicative of replicating virus
PRRS…RFLP • Restriction Fragment Length Polymorphism • Utilizes RT-PCR of ORF 5 gene • Envelop proteins • Prone to mutation • 3 Restriction Enzymes Used • Their cutting patterns are assigned numbers • I.e. 1-4-2, 2-1-2, 2-6-2, 1-5-2
RFLP…Interpretation • May differentiate between vaccine virus (2-5-2) and wild-type virus • No indication of virulence • No indication on cross-protection • Change in RFLP can be from 1 base pair substitution…careful interpretation • Little indication of homology (4%)
“Open reading frame 5 of PRRSV was sequenced. This PRRSV has a predicted RFLP cut pattern of 2-5-2 and differs from each of the 3 modified-live PRRS vaccine viruses (Ingelvac/RespPRRS, Ingelvac ATP, PrimePac) by more than .5%.” University of MN RFLP…Example
“RFLP cut patterns are usually an inaccurate measure of PRRSV relatedness.” University of MN RFLP…Example
PRRS Genetic Sequencing • Provides exact nucleotide sequence of ORF • Utilize ORF 5 b/c most variable • Therefore, more informative than RFLP • Dendograms (phylogenetic tree) can be made and homologies can be seen
ORF 5 Genetic Sequencing ATGTTGGAGAAATGCTTGACCGCGGGCTGTTGCTCGCGATTGCTTTCTTTGTGG TGTATCGTGCCGTTCTGTTTTGCTGTGCTCGCCAACGCCAGCAACAACAGCAGC TCCCATCTACAGCTGATTTACAACTTGACGCTATGTGAGCTGAATGGCACAGATT GGCTAGCTAACAAATTTGATTGGGCAGTGGAGAGTTTTGTCATCTTTCCCGTTTT GACTCACATTGTCTCCTATGGTGCCCTCACTACCAGCCATTTCCTTGACACAGTC GCTTTAGTCACTGTGTCTACCGCCGGGTTTGTTCACGGGCGGTATGTCCTAAGT AGCATCTACGCGGTCTGTGCCCTGGCTGCGTTGACTTGCTTCGTCATTAGGTTT GCAAAGAATTGCATGTCCTGGCGCTACGCGTGTACCAGATATACCAACTTTCTT CTGGACACTAAGGGCATACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAA AAGGGGCAAAGTTGAGGTCGAAGGTCATCTGATCGACCTCAAAAGAGTTGTGC TTGATGGTTCCGTGGCAACCCCTATAACCAGAGTTTCAGCGGAACAATGGGGTC GTCCTTAG >550 Nucleotides
5.14.06 6.2.06
Sequencing and Dendograms • = Phylogenetic analysis • Nucleotide sequencing
Genetic Sequencing • Homologies do not indicate cross-protection • Homologies do not predict pathogenicity • Homologies only indicate relatedness
PRRS…SVN (SN) • Serum Virus Neutralization • PRRS SVN not used widely • Possible direct correlation with protective antibodies in vivo • Alpha and beta procedures • Beta utilized for PRRS
SVN…Procedure • Beta Procedure • Known levels of standard virus incubated with serial dilutions of test serum • Serum is then added to sensitive cell lines • Titer of serum = Highest dilution of serum that neutralizes known dose of virus • End points are shown by cytopathology
SVN Results • Less sensitive than IFA or ELISA • Neutralizing Ab produced slow PI ( >21 days) • Levels of nAb are pig-dependent • Detectable 9-28 days PI • Max titers at 2-3 months PI • Persistent titers > 1 year PI
SVN…Interpretation • Assumed that shedding of virus is nill if nAb is present • However, PRRS produces carrier-state animals • REMEMBER: • ARTERIVIRUS
PRRSv Detection in Tissues • Histopathology • PCR • VI • IHC • DFA
PRRS…Histopathology • Interstitial pneumonia • Thickened alveolar walls • Pneumocyte hypertrophy/hyperplasia • Alveolar spaces filled with necrotic debris and WBC’s
PRRS…Histopathology Normal Interstitial pneumonia T. Opriessnig, 2004
A C T G PCR…Process Annealing DNA Heat Denaturing Primers and Cooling Taq + Nucleotides Reverse Transcriptase 30 Cycles Complementary Strands RNA
PRRS…VI • Virus Isolation • Lung, Tonsil, Lymph nodes • Autolysis greatly affects sensitivity • Much easier to find in serum
PRRS…IHC • Immunohistochemistry • Antibody coupled to horseradish peroxidase • H2O2/Benzidine derivative added • Colored insoluble precipitate formed Halbur, AASV
PRRS…DFA • Direct Fluorescent Antibody • Fluorescein conjugated to antiviral antibody • PRRSv infected tissue
DFA…Results • Quick, Cheap • Specific • Less sensitive…autolysis
Semen PRRSv PCR • Specific • Less Sensitive • Intermittent Shedding • Detectable Levels > Infectious Levels
Other Respiratory Diagnostics • I request many of the same diagnostic tests for different respiratory diseases. • If you feel like you are lost when you are out in practice, call the lab you are working with and the diagnosticians are more than happy to help you out and explain more about what they do.