1 / 70

Mistérios Moleculares da Vassoura de Bruxa

Mistérios Moleculares da Vassoura de Bruxa. Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04. Basis. Organism. Gene. Genomics Discover that the Organism Y has a gene similar to the Gene A found in the Organism X. Biochemistry Discover the function of the Gene A

earl
Download Presentation

Mistérios Moleculares da Vassoura de Bruxa

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mistérios Moleculares da Vassoura de Bruxa Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04

  2. Basis Organism Gene Genomics Discover that the Organism Y has a gene similar to the Gene A found in the Organism X Biochemistry Discover the function of the Gene A in the Organism X A(Y) ~ A(X)

  3. Sequencing Bioinformatics Expression Analysis Genomics Tools Organism Raw Sequence Putative Genes Cellular Program

  4. Genomics Mission Genomics X Trial and Error Hypothesis for Targets Definition

  5. 3 Mb ATG CT Genome Xylella fastidiosa Bioinformatics ATGGGCCTTTG CTTTGCCCCCAAA TGCCCCCAAAAGGGGG AAAGGGGGAAAAG 50 kb ATGGGCCTTTGCCCCCAAAAGGGGGAAAAG AGGGGGAAAAGTTTGC CCTGGGGGATGGGCCTTTGC 50 kb Identification of genes 1 a 2 kb Sequencing

  6. Virtual Metabolism BLAST

  7. Publication

  8. More

  9. and more.... Xylella fastidiosa - Pierce's Disease Strain: Grape phytopathogen Leifsonia xyli subsp. xyli (Sugarcane phytopathogen) Leptospira Eucalyptus Coffee Caw

  10. Agriculture improvement Human diseases Herbaspirillum seropedicae Leishmania chagasi Gluconacetobacter diazotrophicus Schistosoma mansoni Eucalyptus Trypanossoma cruzi Paracoccidioides brasiliensis Regional Genomes Phytopathogen Crinipellis perniciosa

  11. Samba, football and ..... Genomics

  12. Practical Results ????????????

  13. Cacau Production in Brazil Thousand Tons

  14. International Price

  15. Cacau Income U$ Billion

  16. U$ Million Witche’s Broom Loses 100.000 ha Forest U$ 1.380.000.000,00 300.000 jobs

  17. Goals of the Witch's Broom Genome Project Pragmatic 1. Build a Genomics Network at the State of Bahia to face biological problems 2. Create the basis to understand the Witch's Broom disease, indicating possible solutions

  18. Symptoms - 1 Fotos - João de Cássia - CEPEC-CEPLAC

  19. Symptoms - 2 Fotos - João de Cássia - CEPEC-CEPLAC

  20. Symptoms - 3 Fotos - João de Cássia - CEPEC-CEPLAC

  21. Crinipellis perniciosa Fotos - João de Cássia - CEPEC-CEPLAC

  22. Meiose Differentiation Life Cycle

  23. ATG CT CT ATG ATG CT CT ATG ATG (?) CT Complexity X Strategy Prokaryotes ~ 3 Mb 1G/1Kb Eukaryotes Fungi - Saccharomyces cerevisiae ~ 20 Mb 1G/2Kb Human ~3.000 Mb 1G/75 Kb

  24. Sequencing X Coverage Contigs Singlets

  25. Gaps X Coverage 303 >1000bp 2X 1X

  26. 20 Kb 3 reads Sequencing Strategy Genomic Shotgun 40 reads: 500 bp/each

  27. Libraries Libraries Sequences Sequences Bahia Genomics Network DNA Coordination UNICAMP UESC CEPLAC CENARGEN UNICAMP UFBA-Farmácia UFBA- IB UEFS UCSAL Databank Bioinformática UNICAMP/UESC Interface Cacau Research Community

  28. Chips Molecular Mapping Inactivation Structural Analysis Data Treatment: “on going” annotation Shotgun Assembling BACs Blast Complete Genome Pre-Annotated Read Metabolic Maps Local clustering ORFs Representative Read Proteomics

  29. Geração Controle Análise Bioinformatics Services Serviços Sequence submission Nomenclature Nomenclature edition Submission test Administrative services Keyword search in Blast files Anotation (test) Annotated seeds Contigs progress Sequence pattern search Blast against C. perniciosa Blast results - All reads Sequence analysis tools (Emboss) Access control Access control (graph) Library Control Strain Labs productivity Labs productivity graphs Labs productivity graphs (cumulative) Quality Bug reports Gene Project

  30. Selection: File, Keyword, Blast, Seq. pattern, all Assembling: PPC, Saturation Blast of consensus Analysis: ORF finder, Comparison, Prediction Gene Project* Data bank: Blasted reads Selected reads Assembled Reads Consensus Annotated Gene *Carazzolle, MF, Digiampietri, L, Araújo, MRS, Formighieri, EF, Tsukumo, F & Pereira, GAG

  31. Nc, Sc, Sp, Cp Nc, Sc, Cp Glucose- 6-phosphate 5. 3. 1. 9 Fructose-6- phosphate Only Nc Glutamine None 2. 6. 1. 16 Glutamate 3. 2. 1. - 2. 7. 1. 1 Glucosaminide Glucosamine Glucosamine-6- phosphate ATP ADP 2. 3. 1. 4 3. 5. 1. 25 AcetylCoA CoA 5. 4. 2. 3 N-Acetylglicosamine-1- phosphate N-Acetylglucosamine-6-hosphate UTP 3. 2. 1. 132 ADP 2. 7. 7. 23 2. 7. 1. 59 pyrophosphate ATP UDP-N-Acetilglicosamina N-Acetylglucosamine 2. 4. 1. 16 UDP 3. 2. 1. 52 3. 2. 1. 14 Chitobiose Chitosan CHITIN 3. 5. 1. 41 Chitin Metabolism Goes-Neto, Priminho, et. Al UEFS

  32. Control Infected Phases DAI 1 3 2 7 3 14 4 21 5 35 6 61 7 130 Biochemistry of Infection - 1 Ph.D. Work: Leandra Scarpari; Supervisor: Gonçalo Pereira; Co-supervisors: Paulo Mazzafera e Alan Pomella Acknowledge: Almirante Cacau

  33. Açucar Solúvel Amido Component > Control > Inoculated No Diference Açucares - Solúveis totais XXX - Sacarose XXX - Amido XXX - Hemicelulose XXX - Açúcares redutores XXX - Celulose XXX - Pectinas XXX Aminoácidos Quantitativo XXX Qualitativo *** ASP, GLUASN Fenóis totais XXX Taninos XXX Nitrato XXX Flavonóides totais XXX Clorofilas e carotenóides XXX Hormônios Etileno XXX Auxina Citocinina Hemicelulose AA - Total AA - Inoculado AA - Controle Flavonóides Totais Clorofila Total Biochemistry of Infection - 2

  34. C Asparagina Acido Glutâmico I Biochemistry of Infection - 3 The infection triggers the plant Programmed Cell Death - PCD

  35. Tunnel

  36. C S L 1. S. cerevisiae + H. wingei (Bio Rad) 2. CP02 (Biótipo C) 3. CP09 (Biótipo C) 4. FA42 (Biótipo C) 5. Ilhéus (Biótipo C) 6. FA104 (Biótipo S) 7. SCFT (Biótipo L) 8. FA322 (Biótipo L) 9. S. pombe 10. S. cerevisiae Molecular Features 1 2 3 4 5 6 7 8 9 10 Rincones, J, Meinhardt, L, Vidal, B & Pereira, GAG

  37. 5.2 4.6 3.1 3.5(3) 2.8(2) Genome Size 29 Mb

  38. I II Amazônicos II Genome Variability Bahia Probably only two clones of C. perniciosa have been introduced in Bahia

  39. Bahia A1-R Bahia A1 I I II II 3054 bp 2036 bp 1636 bp 1018 bp 517 bp Telomeric PCR Meinhardt, L, Rincones, J. & Pereira, GAG

  40. Rondônia???? Amazônicos

  41. Genetic Solution Creation of strict sanitary barriers between Amazonia and Bahia

  42. M L S U 1 2 3 4 5 6 P B S C C L Reverse Trancriptase 394 S C C L S C C L Restless-like Impala-like Class I Super-family Gypsy/Ty3 Transposons Marisa Queiroz - UFV

  43. Transposon Distribuition

  44. Meioses Variability Dynamics 1. Cromossomal variations can be immediately fixed 2. Variability may raise by mutation and transposons 3. Why we do not see higher variability in Bahia???? Homobasidiomycete ??? Sexual Phase

  45. Mitochondria

  46. Kalilo - like Senescence 109 kb

  47. Senescence Waves Hugo

  48. Alternative Oxidase C. perniciosa Alternative Oxidase

  49. Recommendations 1. Strobirulin based fungicides are ineffective at the field 2. Inhibition of mitochondria may be effective to control the disease and could be achieved by combining strobirulin and Sham analogues

More Related