slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
VARiD : A Variation Detection Framework for Color- and Letter-Space platforms PowerPoint Presentation
Download Presentation
VARiD : A Variation Detection Framework for Color- and Letter-Space platforms

Loading in 2 Seconds...

play fullscreen
1 / 31

VARiD : A Variation Detection Framework for Color- and Letter-Space platforms - PowerPoint PPT Presentation

  • Uploaded on

VARiD : A Variation Detection Framework for Color- and Letter-Space platforms. Adrian Dalca 1,2 , Steven Rumble 3 , Sam Levy 4 , Michael Brudno 2,5. Massachusetts Institute of Technology University of Toronto Stanford University The Scripps Research Institute

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about 'VARiD : A Variation Detection Framework for Color- and Letter-Space platforms' - dung

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

VARiD: A Variation Detection Framework for Color- and Letter-Space platforms

Adrian Dalca1,2, Steven Rumble3, Sam Levy4, Michael Brudno2,5

Massachusetts Institute of Technology

University of Toronto

Stanford University

The Scripps Research Institute

Donnelly Centre and the Banting and Best Department of Medical Research


Variation detection from NGS reads

  • Determine differences (variation) between reference and donorusing NGS reads of the donor


Donor: ???????????????????????????????????????



Aligned reads: ATCCATTGCA


motivation | methods | results | summary



    • Color-spaceand Letter-space platforms
  • bring them together





Sequencing Platforms

> NC_005109.2 | BRCA1 SX3


  • letter-space
  • Sanger, 454, Illumina, etc

> NC_005109.2 | BRCA1 AF3


  • color-space
  • AB SOLiD
  • less software tools available
  • many differences -> useful to combine this information
  • sequencing biases
  • inherent errors
  • advantages

motivation | methods | results | summary


Color Space

Translation Matrix

Translation Automata

> T212313230313232121311120

motivation | methods | results | summary


Color Space


> T212313230313232121311120

> T



























Sequencing Error vs SNP

Sequencing Error

> T212313230313232121311120

> T212313230310232121311120




> T212313230312332121311120



motivation | methods | results | summary


Color Space

  • clear distinction between a sequencing error and a SNP
  • can this help us in SNP detection? sounds like it!
    • single color change  error,
    • 2 colors changed  (likely) SNP.

Difficult Case

Well covered bases

Easy snp call

reference in




motivation | methods | results | summary



  • Motivation
    • variation caller to handle both letter-space & color-space reads
  • Detection
    • Heterozygous SNPs
    • Homozygous SNPs
    • Tri-allelic SNPs
    • small indels
    • account for various errors, quality values & misalignments
  • VARiD
    • system to make inferences on the donor bases
      • variation detection

motivation | methods | results | summary



  • Methods
  • Simple HMM Model
  • states, emissions, transitions, FB
  • Extended HMM Model
  • gaps, diploids, exceptions




Hidden Markov Model (HMM)

Statistical model for a system - states

Assume that system is a Markov process with state unobserved.

Markov Process: next state depends only on current state

We can observe the state’s emission (output)

each state has a probability distribution over outputs










motivation | methods | results | summary


Hidden Markov Model (HMM)

  • Apply HMM to variation detection:
  • we don’t know the state (donor), but
  • we can observe some output determined by the state (aligned reads)

motivation | methods | results | summary


Hidden Markov Model (HMM)


. . . . . B6 B7 B8 B9 . . . . .

B6 B7

B7 B8

B8 B9







color 0

color 0

color 0

color 1

color 1

color 1

motivation | methods | results | summary



B6 B7

  • The donor could be:
  • letters: AA color 0
  • letters: AC color 1
  • :
  • letters: TT color 0
  • 16 combinations
  • Why pairs of letters? Handle colors.
  • AA and TT gives the same colors. Can’t just model colors

motivation | methods | results | summary



  • States
  • 16 possible states
  • only look at second letter

. . . B6 B7 B8 . . .

B6 B7

B7 B8














  • Transitions
  • only certain transitions allowed
  • when allowed, p(Xt|Xt-1) = freq(Xt)
  • each state depends only on the previous states (Markov Process)


Possible States








motivation | methods | results | summary





B7 B8

..... B6B7B8B9 .....

color 0






color 1

color 0









motivation | methods | results | summary


Emission Probabilities





color 0

1 – 3ε


color 1


Same color emission


color 2


color 3


letters A


letters C



letters G


Different letter emission


letters T


motivation | methods | results | summary


Emission Probabilities

..... B6B7B8B9 .....

  • Combining emission probabilities
  • probability that this state emitted these reads.




E.g. For state CC:




motivation | methods | results | summary


Simple HMM

  • Summary
  • unknown state
    • donor pair at location
  • transitions
    • transition probabilities
  • emissions
    • reads at location
    • emission probabilities

B6 B7



color 0

color 1

motivation | methods | results | summary


Forward-Backward Algorithm

  • Have set-up a form of an HMM
  • run Forward-Backward algorithm
  • get probability distribution over states at each position



likely state





  • Variation Detection:
  • compare most likely state with reference:
  • ref: GCTATCCA
  • don: ...AT...






motivation | methods | results | summary



  • Methods
  • Simple HMM Model
  • states, emissions, transitions, FB
  • Extended HMM Model
  • gaps, diploids, exceptions




Extended HMM

  • Simple HMM
    • only detects homozygousSNPs
  • Extended HMM:
    • short indels
    • heterozygousSNPs
    • complex error profiles & quality values

motivation | methods | results | summary


Expansion: Gaps and heterozygous SNPs

  • Expand states
    • Have states that include gaps
      • emit: gap or color





  • Have larger states, for diploids


  • Transitions built in similar fashion as before
  • Same algorithm, but in all we have 1600 states with very sparse transitions

motivation | methods | results | summary



  • Emission probabilities
  • Support quality values
  • Use variable error rates for emissions

Donor: ACAGCATCGGCATCGACTGC1123132303123321213read: >T2123132303123321213 > C123132303123321213

  • Translate through the first color
    • first color is incorrect
    • letter-space signal
  • Post-process putative SNPs
    • correlated adjacent errors may support het SNPs
    • check putative SNPs

motivation | methods | results | summary



blue: varid steps

motivation | methods | results | summary








  • Human dataset from Harismendy et al, 2009. (NA17156,17275,17460,17773)
  • 454, SOLiD, Sanger
  • Color-space dataset:
  • Compare random subsets:
    • Corona (with AB mapper)
    • VARiD (with SHRiMP)
    • VARiD (with AB mapper)
  • Conclusions:
  • the three pipelines perform
  • very similarly.
  • High-coverage results is as good as can be achieved


motivation | methods | results | summary




  • Letter-space dataset:
  • Compare random subsets :
    • GigaBayes (with Mosaik)
    • VARiD (with SHRiMP)
    • VARiD (with Mosaik)
  • Conclusion:
  • the three pipelines perform
  • very similarly.
  • High-coverage results is as good as can be achieved

motivation | methods | results | summary



VARiD Motivation:

Combining Letter-space and Color-space data to achieve increased accuracy in at-cost comparison


Assuming a same-cost

comparison of:

  • 10x letter-space (LS)
  • 100x color-space (CS)
  • 5x LS and 50x CS

motivation | methods | results | summary








  • Summary of VARiD
  • HMM modeling underlying donor
  • Treats color-space and letter-space together in the same framework
  • no translation – take advantage of each technology’s properties
  • accurately calls SNPs, short indelsin both color- and letter-space
    • improved results with hybrid data.
  • Website: (VARiD freely available)
  • Contact:

motivation | methods | results | summary



  • Acknowledgements
  • Steven Rumble, Sam Levy, Michael Brudno
  • MiskoDzamba


  • Partial Participant Support Award :
  • ISCB, Department of Energy, and National Science Foundation
  • Website: (VARiD freely available)
  • Contact:

motivation | methods | results | summary