slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Who Needs Vitamin C? PowerPoint Presentation
Download Presentation
Who Needs Vitamin C?

Loading in 2 Seconds...

play fullscreen
1 / 10

Who Needs Vitamin C? - PowerPoint PPT Presentation


  • 149 Views
  • Uploaded on

Who Needs Vitamin C? . “Vitamin C is unique…as its essentiality as a nutrient is restricted to only a limited number of exceptional species among phylogenetically higher animals. In other words, nearly all higher animals can synthesize vitamin C…”. 1991. Scurvy. R.I.P. Vitamin C.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Who Needs Vitamin C?' - dingbang


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
who needs vitamin c
Who Needs Vitamin C?

“Vitamin C is unique…as its essentiality as a nutrient is restricted to only a limited number of exceptional species among phylogenetically higher animals. In other words, nearly all higher animals can synthesize vitamin C…”

1991

slide3

Scurvy

R.I.P.

Vitamin C

james lind 1716 1799
James Lind(1716 – 1799)

“…the most sudden and visible good effects were perceived from the use of the oranges and lemons; one of those who had taken them, being at the end of six days fit for duty.”

A treatise of the scurvy, 1753

evolution is testable scurvy vitamin c and common ancestry

Orangutans

Monkeys

Guinea Pigs

Chimpanzees

1907 Scurvy occurs in guinea pigs.

1957 Scurvy due to lack of enzyme.

1913 Scurvy occurs in other primates.

1934 Vitamin C artificially synthesized.

1933 Vitamin C identified and described.

Gibbons

Gorillas

Tarsiers

Evolution is TestableScurvy, Vitamin C, and Common Ancestry

1933: Vitamin C identified and described.

1934: Vitamin C artificially synthesized.

1913: Scurvy occurs in other primates.

1957: Scurvy due to lack of enzyme.

1907: Scurvy occurs in guinea pigs.

vitamin c production

enzyme

2

enzyme

3

enzyme

1

D-GLUCURONIC

ACID

D-GLUCURONIC

ACID LACTONE

L-GULONO-

LACTONE

2-KETO-GULONO-

GAMMA-LACTONE

L-ASCORBIC

ACID

D-GLUCOSE

Vitamin C Production

enzyme

4

“GULO”

“VITAMIN C”

Prediction: If the ancestors of humans, other higher primates, and guinea pigs originally had the ability to synthesize vitamin C, then each of these species should carry evidence of this lost ability in their genes.

slide7

TACCCCGTGGAGGTACGCTTCACTCGCGGGGACGACATCCTGCTGAGCCCC

TACCCTGTGGGGGTGCGCTTCACCCGGGGGGACGACATCCTGCTGAGCCCC

TAACCGGTGGGGGTGCGCTTCACCCAAGG-GATGACATCATACTGAGCCCC

TACCCGGTGGGGGTGCGCTTCACCCAGAG-GATGACGTCCTACTGAGCCCC

TACCTGGTGGGGCTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC

TACCTGGTGGGGGTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC

GATGACATCATACTGAGCCCC

GATGACGTCCTACTGAGCCCC

GATGACATCCTACTGAGCCCC

GATGACATCCTACTGAGCCCC

TGA

TGA

TGA

TGA

premature STOP codons

TGA

premature STOP codon

2-KETO-GULONO-

GAMMA-LACTONE

L-ASCORBIC

ACID

GULO-related sequence comparison from exon X

COW

GUINEA PIG

MACAQUE

ORANG

CHIMP

HUMAN

GULO-related sequence comparison from exon III

COW

GUINEA PIG

CACTCGCCCTCAGACATCGCCTGCACTGACGGCTTCATGATCCACATGGGC

CACTCCCCCTCCGACATTGCCTGAACAGAGGGCATCATGATCCACAGGGGC

enzyme

1

enzyme

2

enzyme

3

enzyme

4

“GULO”

STOP

D-GLUCURONIC

ACID

D-GLUCURONIC

ACID LACTONE

L-GULONO-

LACTONE

D-GLUCOSE

slide8

Human

Orangutan

Macaque

Guinea Pig

Cow

Chimpanzee

Deactivation of

GULO enzyme

brought to you by
Brought To You By:

www.anevolvingcreation.net/standup/