BLAST - PowerPoint PPT Presentation

slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
BLAST PowerPoint Presentation
play fullscreen
1 / 8
Download Presentation

BLAST

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. BLAST The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. BLAST can be used to infer functional and evolutionary relationships between sequences as well as help identify members of gene families. http://www.ncbi.nlm.nih.gov/blast

  2. Nucleotide BLAST

  3. Protein BLAST

  4. >gi|114520617|ref|NM_021130.3| Homo sapiens peptidylprolyl isomerase A (cyclophilin A) (PPIA), mRNA GAACGTGGTATAAAAGGGGCGGGAGGCCAGGCTCGTGCCGTTTTGCAGACGCCACCGCCGAGGAAAACCG TGTACTATTAGCCATGGTCAACCCCACCGTGTTCTTCGACATTGCCGTCGACGGCGAGCCCTTGGGCCGC GTCTCCTTTGAGCTGTTTGCAGACAAGGTCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCACTGGAG AGAAAGGATTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCAGGGTGGTGA CTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGAAGATGAGAACTTCATC CTAAAGCATACGGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCCAGTTTT TCATCTGCACTGCCAAGACTGAGTGGTTGGATGGCAAGCATGTGGTGTTTGGCAAAGTGAAAGAAGGCAT GAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCT GACTGTGGACAACTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTGTAGCTC AGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGCTCTCGCTGCAGTTCCCTT TGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAGCTGGATTGCAGAGTTAAGTTTATGATTATGAAA TAAAAACTAAATAACAATTGTCCTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGCAGTAAT GGGTTACTTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACTTTCCAGTC CCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCAGCAACTGGGCATGGTGGCTCACT GTCTGTAATGTATTACCTGAGGCAGAAGACCACCTGAGGGTAGGAGTCAAGATCAGCCTGGGCAACATAG TGAGACGCTGTCTCTACAAAAAATAATTAGCCTGGCCTGGTGGTGCATGCCTAGTCCTAGCTGATCTGGA GGCTGACGTGGGAGGATTGCTTGAGCCTAGAGTGAGCTATTATCATGCCACTGTACAGCCTGGGTGTTCA CAGATCTTGTGTCTCAAAGGTAGGCAGAGGCAGGAAAAGCAAGGAGCCAGAATTAAGAGGTTGGGTCAGT CTGCAGTGAGTTCATGCATTTAGAGGTGTTCTTCAAGATGACTAATGTCAAAAATTGAGACATCTGTTGC GGTTTTTTTTTTTTTTTTTTCCCCTGGAATGCAGTGGCGTGATCTCAGCTCACTGCAGCCTCCGCCTCCT GGGTTCAAGTGATTCTAGTGCCTCAGCCTCCTGAGTAGCTGGGATAATGGGCGTGTGCCACCATGCCCAG CTAATTTTTGTATTTTTAGTATAGATGGGGTTTCATCATTTTGACCAGGCTGGTCTCAAACTCTTGACCT CAGCTGATGCGCCTGCCTTGGCCTCCCAAACTGCTGAGATTACAGATGTGAGCCACCGCACCCTACCTCA TTTTCTGTAACAAAGCTAAGCTTGAACACTGTTGATGTTCTTGAGGGAAGCATATTGGGCTTTAGGCTGT AGGTCAAGTTTATACATCTTAATTATGGTGGAATTCCTATGTAGAGTCTAAAAAGCCAGGTACTTGGTGC TACAGTCAGTCTCCCTGCAGAGGGTTAAGGCGCAGACTACCTGCAGTGAGGAGGTACTGCTTGTAGCATA TAGAGCCTCTCCCTAGCTTTGGTTATGGAGGCTTTGAGGTTTTGCAAACCTGACCAATTTAAGCCATAAG ATCTGGTCAAAGGGATACCCTTCCCACTAAGGACTTGGTTTCTCAGGAAATTATATGTACAGTGCTTGCT GGCAGTTAGATGTCAGGACAATCTAAGCTGAGAAAACCCCTTCTCTGCCCACCTTAACAGACCTCTAGGG TTCTTAACCCAGCAATCAAGTTTGCCTATCCTAGAGGTGGCGGATTTGATCATTTGGTGTGTTGGGCAAT TTTTGTTTTACTGTCTGGTTCCTTCTGCGTGAATTACCACCACCACCACTTGTGCATCTCAGTCTTGTGT GTTGTCTGGTTACGTATTCCCTGGGTGATACCATTCAATGTCTTAATGTACTTGTGGCTCAGACCTGAGT GCAAGGTGGAAATAAACATCAAACATCTTTTCATTA

  5. http://www.ncbi.nlm.nih.gov/

  6. DOWNLOAD: blast-2.2.18-ia32-win32.exe netblast-2.2.18-ia32-win32.exe

  7. Blast NCBI Database netblast-2.2.18-ia32-win32.exe Create a folder “NETBLAST” in “C” Drive Download netblast-2.2.18-ia32-win32.exe Decompress the file COMMAND 開始執行cmd cd/ cd\NETBLAST\ blastcl3 -p blastn -i c:\NETBLAST\FILENAME -d nr -o c:\NETBLAST\FILENAME-BLASTn_-nr.txt -p program -I input file -d database -o output file OPTIONS: -m 8 tubular output -b 1 list one description -v 1 show one alignment EXERCISE: Use the sequence file from last week’s homework to do a netblast WITH & WITHOUT options

  8. Blast Local Database blast-2.2.18-ia32-win32.exe Create a folder “NETBLAST” in “C” Drive Download blast-2.2.18-ia32-win32.exe Decompress the file COMMAND 開始執行cmd cd/ cd\BLAST\bin CREATE LOCAL DATABSE formatdb -p T -o T -i c:\BLAST\FILENAME (protein) formatdb -p F -o T -i c:\BLAST\FILENAME (nucleotide) LOCAL BLAST blastall -p blastp-i c:\BLAST\FILENAME -d c:\BLAST\DATABASE -o c:\BLAST\BLASTx-FILENAME.txt -p program -I input file -d database -o output file OPTIONS: -m 8 tubular output -b 1 list one description -v 1 show one alignment EXERCISE: Reformat the sequence file from last week’s homework as a local database. Use the same sequence to do a blast WITH & WITHOUT options