1 / 28

A Possible Mechanism of Carcinogenesis － The Electric Charge Transport Properties of p53

A Possible Mechanism of Carcinogenesis － The Electric Charge Transport Properties of p53. arXiv:q-bio/0708.3181; 0710.1676. C. T. Shih （施奇廷） Dept. Phys., Tunghi University 2007/10/08 Dept. Physics, National Tsing-Hua University. Collaborators:

devi
Download Presentation

A Possible Mechanism of Carcinogenesis － The Electric Charge Transport Properties of p53

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A Possible Mechanism of Carcinogenesis － The Electric Charge Transport Properties of p53 arXiv:q-bio/0708.3181; 0710.1676 C. T. Shih（施奇廷） Dept. Phys., Tunghi University 2007/10/08 Dept. Physics, National Tsing-Hua University • Collaborators: • Rudolf A. Römer, Department of Physics and Center for Scientific Computing, University of Warwick, United Kingdom • Stephan Roche, CEA/DSM/DRFMC/SPSMS, Grenoble, France

  2. Outline • Mutation of p53 tumor suppressor and cancers • A possible mechanism of DNA damage/repair • Scenario: how cancerous mutations get rid of the repair process • Model and method • Results and Discussion

  3. Mutation of p53 tumor suppressor and cancers Guardian of the Genome

  4. Mutants of p53 genes Summary of carcinogens and mutational events that can alter the p53 genes

  5. Functional Significance of p53 • Activate DNA repair proteins when DNA has sustained damage • Hold the cell cycle at the G1/S regulation point on DNA damage recognition (if it holds the cell here for long enough, the DNA repair proteins will have time to fix the damage and the cell will be allowed to continue the cell cycle.) • Initiate apoptosis, the programmed cell death, if the DNA damage proves to be irreparable

  6. Role of p53 tumor-repressor protein

  7. Database: IARC (France)http://www-p53.iarc.fr/index.html Version R11 (Oct 2006): 23544 records 20366 point mutations

  8. DNA: A Schematic View

  9. A possible mechanism of DNA damage/repair • BER (base excision repair) enzyme with [Fe4S4]2+ cluster – robust to oxidation in the absence of DNA • BER binding to DNA – oxidation activated ([Fe4S4]2+ →[Fe4S4]3+) and an electron is mediated • If another BER enzyme is at a distant site, the electron will be caught by the BER. The second BER will be reduced ([Fe4S4]3+ →[Fe4S4]2+) and dissociated • A base lesion can preclude the DNA mediated charge transport. BER will remain localized in the vicinity of the lesion and diffuse to the site to excise the base E. Yavin et al. (JK Barton group), PNAS 103, 3610 (2006).

  10. Electron Paramagnetic Resonance Experiment

  11. Models for Electric Transport of DNA – 1D • 1L: 1-leg model • :hopping integral between the i-th and (i+1)-th nucleotide • : on-site potential of the basepair • FB (fishbone model) = 1L + hopping between backbone and basepair ( ) + on-site potential of the backbone ( ) • DNA for 1≦i≦N and semi-infinite electrodes for i＜1 and i＞N Energy Parameters • On-site potential = 8.24eV, = 8.87eV, = 7.75eV and = 9.14eV • 1L: The hopping between pairs base is taken to be = 0.4eV • FB: hopping onto the backbone is 0.7eV and the backbone onsite energy is taken to be 8.5eV Using transfer matrix method to calculate transmission coefficient T(E) for incident energy E

  12. Models for Electric Transport of DNA – 2D • 2L: 2-leg model • : hopping integral between the two strands • LM (ladder model) = 2L+hopping between backbone and basepair + on-site potential of the backbone • DNA for 1≦i≦N and semi-infinite electrodes for i＜1 and i＞N Energy Parameters • 2L: The hopping between like base pairs (AT/AT, GC/GC, etc.) is chosen as 0.35eV, between unlike base pairs it is 0.17eV, = 0.1 eV • LM: Intrachain and interchain hopping strengths are as in the two-leg model. In addition, the backbone is treated as in the fishbone model. Using transfer matrix method to calculate transmission coefficient T(E) for incident energy E

  13. Transmission Coefficient: Transfer Matrix Method E: Energy of injected carrier; T(E): Transmission coefficent

  14. Sequence-Dependent Transport

  15. Sequence-Dependent Transport

  16. T(E) changed by point mutations tDNA=tm=1.0 eV Black T0(E): (GC)30 Red Tm(E): 30th base C→G • i: beginning site of the subsequence • w: length of the subsequence • k: mutated site • s’: mutant base • (Emin, Emax)=(5.75, 9.75): energy range of injected carrier • W=4: bandwith in electrodes

  17. Comparison of the cancerous/noncancerous mutations P53 seq.: Mutation: 14585 C→T (found 133 times in IARC Database) AGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGGTAAGCAAGCAGGACAAGAAGCGGTGGAGGAGACCAA • C→T is a cancerous mutation (the 9th highest frequency found in various types of cancer) • C→A and C→G are non-cancerous (not found in the human cancer cells up to now) Energy-dependence of logarithmic transmission coefficients of the original sequence (C solid line) and mutated (A dotted, G dotted-dashed, T dashed) sequences with length L = 20 (from 14575th to 14594th nucleotide) of p53. The left panel shows results for model 1L, the right two panels denote the two transport windows for the fishbone model

  18. Comparison of the cancerous/noncancerous mutations P53 seq.: Mutation: 14585 C→T (found 133 times in IARC Database) AGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGGTAAGCAAGCAGGACAAGAAGCGGTGGAGGAGACCAA Energy-dependence of logarithmic squared differences between the transmission coefficients of the original sequence and mutated (C → T solid line, → A dotted, → G dotted-dashed) sequences. For the all four models, the cancerous mutation C→T results in the weakest change in T(E)!

  19. CT Change for Different Models and Propagation Lengths and A Scenario for Carcinogenesis Cancerous Mutation C→T Lowest CT Change

  20. Scenario: how cancerous mutations get rid of the repair process • The mutations become cancerous – they can get rid of the repair processes • One of the repair processes (proposed by J.K. Barton) is to detect the lesions by probing the DNA mediated charge transport • The point mutations can cause the electric transport properties change of DNA segments containing the mutation points • The transport change of the cancerous mutations must be small, or they will be detected by the electric probing process of BER enzymes • This is a necessary condition, but may not sufficient because there are other repair mechanism

  21. Statistical Analysis for All Possible Mutations • The average effect of a mutation (k, s) of a subsequence with length L on the CT of p53 is defined as • For all 20303×3 = 60909 possible mutations, calculate the G for various L Hotspots, Small CT change Scatter plots of Γ(k, s;w) versus occurrence frequency of all cancerous mutations (k,s) for (a) L = 20 and (b) 80. The sharp peaks at small Γ agree with the scenario that the most cancerous mutations — namely those with high frequency —change the CT only slightly and thus have smaller Γ.

  22. Comparison of the cancerous/noncancerous mutations • Define the following 3 set of the mutations: • M: all 60909 possible mutations • Mc: 1953 mutations found in the IARC database (found in cancer cells at least one time) • Mc,10: 366 mutations found more than 10 times in the IARC database (most cancerous mutations) • For given L, sort the CT results for M according to Γ(k, s;L) and determine the rank r(k, s;L) of the CT change for each mutation (k, s) • A smaller rank means less CT change for the mutation • γ(k, s;L) = 100% × r(k, s;L)/60909 is then the relative rank in percentage

  23. Statistical Analysis for All Possible Mutations – The Histograms of the Distribution of γ(k, s;L) Many mutations in Mc,10 have smaller CT change (G) on the average The tendency is stronger in L=80 case • Histogram of the distribution of γ(k, s;L) in Mc (light wide bars) and Mc,10 (dark thin bars) which changes the kth nucleotide to s for (a) L = 20 and (b) 80. • For M, all values are equal to 5% (20 intervals) as indicated by the horizontal dashed lines. • (c) shows the percentage of Γ(k, s;L) values inMc,10 for small CT change as a function of DNA lengths in the range 0–5% (black), 5–10% (dark grey), 10–15% (light grey) and 15–20% (white). • Similarly, (d) indicates large CT change forMc,10 in the ranges 80–85% (black), 85–90% (dark grey), 90–95%(light grey) and 95–100% (white). • The horizontal dashed lines in (c) and (d) indicates the distributions forM. The number of mutations whose g larger than 80% Is less than average for all L More than 50% of the mutations in Mc,10 has there g smaller than 20% for L~90

  24. The conductance of hotspots of cancerous mutations is smaller than that of other sites On average the cancerous mutations of the gene yield smaller changes of the CT The tendency is stronger in the set of highly cancerous mutations with occurence frequency > 10 These results suggest a scenario of how cancerous mutations might circumvent the DNA damage-repair mechanism and survive to yield carcinogenesis The results are robust for a wide range of types and parameters of models Our analysis is only valid in a statistical sense Non-cancerous mutations with weak change of CT are observed Other DNA repair processes should exist and we therefore do not intend to claim that the DNA-damage repair solely uses a CT-based criterion Summary

  25. Thank you for your attention!

More Related