Comprehensive Overview of Gene Sequence Variants and Their Functional Implications
10 likes | 107 Views
This document presents an in-depth analysis of genetic sequences, specifically focusing on variations found in the DbldA and M600 genes. It highlights the significance of these variations in biological functions, cellular processes, and potential implications for genetic research. The quantitative assessment of sequences, alongside their corresponding SCO values, provides valuable insights into gene expression regulation and molecular biology. This resource is essential for researchers and students engaged in genetic studies and bioinformatics.
Comprehensive Overview of Gene Sequence Variants and Their Functional Implications
E N D
Presentation Transcript
DbldA 1 DbldA 1 DbldA 1 DbldA 1 M600 1 M600 1 M600 1 M600 1 M600 2 M600 2 M600 2 M600 2 DbldA 2 DbldA 2 DbldA 2 DbldA 2 D D4263 M600 E S E S 4251 4252 4253 SCO 0762 SCO 4253 SCO4252, 4253 and 4262 SCO4246 and 4256 A DbldA M600 DbldA M600 B SCO4251 SCO4252, basic SCO4252, acidic SCO4253 C E ggaacatgcccccgctccggcacccggggacgtttcggca tcggcaacgcgcgcgtgaggctgaggggcgtcctgtctcg taccccgaggagagcagagcatgccgtcctacctgtcgcccggcgtctacgtcgaggaggtggccagcggctcgcgcccg atcgagggagtgggcacgtc