debbiesparks
Uploaded by
18 SLIDES
204 VIEWS
180LIKES

THE QUESTION:

DESCRIPTION

THE QUESTION:. SHOULD I GET A FLU SHOT EACH YEAR?. LEADING CAUSES OF DEATH, UNITED STATES, 1995 Rank Condition Number of Deaths 1 Heart Disease 737,563 2 Cancer 538,455 3 Cerebrovascular disease 157,991 4 Chronic obstructive lung disease 102,899 5 Unintentional injury 93,320

1 / 18

Download Presentation

THE QUESTION:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. THE QUESTION: SHOULD I GET A FLU SHOT EACH YEAR?

  2. LEADING CAUSES OF DEATH, UNITED STATES, 1995 Rank Condition Number of Deaths 1 Heart Disease 737,563 2 Cancer 538,455 3 Cerebrovascular disease 157,991 4 Chronic obstructive lung disease 102,899 5 Unintentional injury 93,320 6 Pneumonia and Influenza 82,923 7 Diabetes 59,254 8 HIV and AIDS 43,115 9 Suicide 31,284 10 Chronic liver diseases 25,222 Modified from: National Center for Health Statistics, Health, United States, 1996-97 and Injury Chartbook, Hyattsville, Maryland: 1997 p.117. “KILLER FLU”

  3. Click on the link below and scroll down to the influenza virus graphic Where are the Hemagglutinin receptors on the virus? What type of nuclear material do you find in the ‘flu’ virus? Can you find the binding sites on the Hemagglutinin receptor? What cells in your body does this virus like to enter? How does the virus enter cells? What happens inside the host cell? What Causes the Flu? Flu Graphic

  4. How is the virus spread? What are the symptoms of the flu? Is there a sector of the population more susceptible to death upon infection? What might the economic impact of influenza virus be? Open the “weekly pneumonia and influenza mortality chart”. Discuss the significance of the peaks in this graph. How might this graph be different if it was monitoring mortality as a % of Australian deaths? Susceptibility, symptoms and spread Influenza

  5. Factors Affecting the Spread of Influenza • Use the Influenza simulation model to explore factors that affect the spread of Influenza within populations. Mac users must open this in Safari • What recommendations can you propose to control the spread of Influenza in a population? Simulation Model click here and then select flu_sim.ppt from the attachments menu for simulation instructions

  6. Update on avian influenza in Asia (17.03.04) The avian influenza outbreak has claimed its 8th victim in Thailand a 39-year-old factory worker who contracted the deadly virus from a neighbor's sick fighting cocks, the health ministry said on Tue 16 Mar 2004. The woman died last Friday, 12 days after she was initially treated for diarrhea, the ministry said in a statement. This 8th death in Thailand brings the total number of human fatalities from avian influenza A (H5N1) virus infection in East Asia to 23. There have been 11 laboratory-confirmed cases of infection in Thailand and 22 confirmed cases in Viet Nam, making the overall total 33. So far 15 of the Vietnamese cases have died. From: ProMED-mail Source: Reuters News online, Tue 16 Mar 2004 [edited]. Should we monitor Influenza virus affecting other animals such as pigs and chickens?

  7. Discuss methods that authorities could employ to control the spread of virus between animals and humans?

  8. Mutations in the Hemagglutinin gene • No antigenic shifts occurred between 1957 ("Hong Kong") and 1968 ("Asian"). So what accounts for the epidemics of 1962 and 1964? • Missense mutations in the hemagglutinin (H) gene. • Flu infections create a strong antibody response. After a pandemic or major epidemic, most people will be immune to the virus strain that caused it. The flu virus has two options: • wait until a new crop of susceptible young people comes along • change the epitopes on the hemagglutinin molecule so that they are no longer recognized by the antibodies circulating in the bodies of previous victims.

  9. Evading the Immune System Evading Immunity • Read about evading immunity, shift and drift, to discover why we don’t keep immunity against the influenza virus. • Discuss weather shift or drift in influenza is of major concern to flu watch centres and health organisations around the world? • View the animation: Genetic reassortment between human and nonhuman influenza A viruses. Discuss the significance of this event for human populations.

  10. You are a member of a vaccine development team. Brainstorm the issues and strategies involved in preparing this years vaccine Use the World Health Organisation site for guidance Why get a flu shot every year? WHO

  11. Exploring the Genome for Influenza When viruses are isolated and sequenced, scientists submit the information into libraries such as GenBank. Nomenclature is based on the parameters shown in the table above.

  12. Phylogenetic Trees Scientists analyse nucleotide sequences of influenza strains to construct phylogenetic trees and study relationships between these strains • Use the phylogenetic tree for influenza A on the following page to discuss the following questions. • Which strain of influenza A is more closely related to the A/Scotland/122/2001 strain? A/Beijing/262/95 OR A/HongKong/52/95 • How would phylogenetic trees assist health organisations to prepare influenza vaccines?

  13. Phylogenetic tree of influenza A H1N1 and H1N2 virus HA1 nucleotide sequences

  14. Constructing Your Own Tree Use Phylogenetic Tree Constructor to explore Hemagglutinin nucleotide sequences from Human influenza virus, Chicken infuenza virus and pig influenza virus Phylogenetic Tree Constructor View data set

  15. Still to come…. • Using BLAST to compare and contrast nucleotide sequences for human influenza A H1N1 from the 1918 epidemic and from a 2003 isolate

  16. The nucleotide sequence on the right is a fragment of the Hemagglutinin gene. Use the codon table to crack the code and find the protein sequence. http://www.zerobio.com/toxin/codon.htm AAACAACTCAACCGACACTGTTGACACAGTACTTGAGAAAAACGTGACAGTGACACACTCAGTCAACCTACTTGAGAACAGTCA Now from the second nucleotide. Does the amino acid sequence change? Translating Nucleotide Sequences

  17. Translating the Hemagglutinin Gene • Use Biology Workbench to find the complete amino acid sequence for the Hemagglutinin gene. Biology Workbench Translation Instructions

  18. Still to come….. • Compare and contrast Hemagglutinin structure in CN-3D

More Related