DNA and Genetics

1. DNA and Genetics Chapters 8 - 13

2. DNA Structure • DNA – deoxyribose nucleic acid • Nucleotides – monomers of DNA • Nucleotides are composed of a phosphate group, a 5 carbon sugar (deoxyribose) and a nitrogenous base • 4 types of nitrogenous bases in DNA: • Adenine • Cytosine • Guanine • Thymine • Chained nucleotides build a strand of DNA • DNA is made of two of these strands • Double stranded – anit-parallel • Double helix

3. Nucleotides Build Strands • DNA forms a twisted ladder structure • Sides of the ladder are formed when the phosphate groups of a nucleotide binds to the 5 carbon sugars of other nucleotides • Rungs of the ladder are formed when nitrogenous bases pair up between strands • Nitrogenous bases pair up under following rules: • Base pairing rules • Adenine always pairs with Thymine (A to T) • Cytosine always pairs with Guanine (C to G)

4. Nitrogenous Bases • 4 types found in DNA [adenine, thymine, cytosine, guanine] • Adenine pairs with Thymine • Cytosine pairs with Guanine • 2 groups of nitrogenous bases: • Purines: adenine and guanine • Pyrmidines: thymine and ctyosine • So: purines pair with pyrmidines and visa versa

10. DNA Replication • Replication of DNA = the process of copying DNA strands • Each chain of nucleotides serves as a template for a new, complimentary, strand • Helicase – the enzyme complex that separates nucleotide chains of DNA • The point of separation is called the replication fork • DNA polymerase – enzyme that allows complimentary nucleotides to build the complimentary chains • 5 prime to 3 prime direction • Replication runs in opposite directions

11. Steps of DNA Replication • Helicase unzips DNA • DNA polymerase attaches at opposite ends of unzipped DNA section • DNA polymerase reads down section from 5 prime to 3 prime while complimentary nucleotides attach to the original strands (the templates)

12. DNA replication • Multiple sites – along a single strand • DNA proofreading • Reduces mutation – change/error in nucleotide sequence – from 1/10,000 to 1/1,000,000,000 [billion] • Specific enzymes repair noncomplimentary bases and errors in nucleotide structure • Johnkyrk.com/DNAreplication

14. RNA • Single stranded • Uracil replaces Thymine • 5 carbon sugar contains extra oxygen [ribose] • 3 kinds: • 1. mRNA – “messenger” – carries complimentary copy of a gene to the cytoplasm • 2. rRNA – “ribosomal” – combines with protein to form ribosomes • 3. tRNA – “transfer” – is used in protein synthesis as specific amino acid carriers (transfer molecules)

15. Transcription

16. Transcription • To make a RNA copy of a DNA segment • To copy a gene • Occurs in the nucleus of cells • Transcription is the process of copying a file (gene) that can be processed and carried to the ribosomes in the cytoplasm and translated into products (proteins)

17. Genes • Segment of DNA that codes for specific products (usually proteins) • Hold the code (file) that can be copied and translated by ribosomes in the cytoplasm • Genes are broken into sections which include: • Promoter region – advertises genes • End with the sequence TATA (TATA box) • Transcription site – segment of gene to be transcribed • Termination signal – marks end of transcription and triggers detachment of all transcription parts

18. Steps of Transcription • Transcription factors find and bind to promoter (TATA box) • RNA polymerase attaches just in front of transcription complex • Phosphate from ATP ignites RNA polym. • RNA polymerase unzips and reads down the template of the transcription site • Complimentary RNA nucleotides are laid down one at a time • RNA polymerase reaches termination signal • Transcription factors, RNA polymerase, newly created RNA copy all detach from gene

22. RNA processing • RNA transcripts include sections called introns and exons • RNA right after transcription is called pre RNA • One of three kinds of pre RNA • Pre mRNA • Pre rRNA • Pre tRNA • Introns are cut out • Exons are spliced together forming the finished RNA (one of three kinds)

24. Homework • Pg 192: 10-2 Review, 1 – 6

25. Translation • mRNA to Protein • Major Players • mRNA: carries the genetic code, copied from the gene in transcription, to build the product: protiens • Ribosomes: made of rRNA and proteins – the workers needed to provide surface for protein building (amino acid/polypeptide chains) • tRNA: transfer RNA • 45 types – correspond to 20 different amino acids • Each specific to the amino acid it’s carrying

26. mRNA • the “messenger” • carries the code (A,U,C,G) in three letter sequences called codons • Codons: code for individual amino acids, starts, or stops – pg. 194 in book • AUG = start codon: codes for the amino acid Methionine • Methionine is always the first amino acid in the sequence • UAA, UGA, UAG = stop codons • each codon corresponds to a complimentary anticodon located on a specific tRNA

27. Ribosomes • two large ribosome subunits attach to mRNA and create two tRNA binding sites • Site “P” is first site of tRNA attachment and refers to the site holding the “p”eptide chain • Site “A” is the second site of tRNA attachment and is the site of where new tRNA are “a”ccepted • Both ribosomal subunits move one codon at a time down the mRNA transcript during translation • As the ribosomes move, the A site becomes the P site and a new A site reveals the site of the next tRNA to attach

28. tRNA • tRNA’s are folded RNA transcripts with two main ends: • 1. anticodon loop: anticodons are three base sequences which correspond to the codons of mRNA code • Anticodons exist at the head of the upside down “t” • 2. amino acid attahment site: at the base of the “t,” sits the specific amino acid being transferred by the tRNA • tRNAs plug into the “A” sites of the ribosomal subunits one at a time as the ribosomes move down the mRNA

34. Translation Animations

35. Steps of Translation • One of two ribsomal subunits attaches at “start” codon of mRNA • tRNA carrying methionine and the anticodon UAC attaches to the P site • The second ribosomal subunit attaches to the mRNA • A second tRNA carrying the anticodon complimentary to the codon of the A site attaches to the A site • As the ribosomal units move to the next codon, methionine binds to the adjacent amino acid found on the tRNA at the A site • The tRNA which carried methionine now breaks off as the ribosomes continue to slide to the next codon • The first A site is now the P site and the next tRNA can bind to the newly adjacent A site • The process repeats until the ribosomes reach the stop codon (either UAA, UGA, or UAG) • The stop codon triggers the ribosomal subunits and the newly formed peptide chain to detach from the mRNA • mRNA can be translated in this way several times before the nucleotides break down and must be recycled back to the nucleus

36. Review • Terms: • DNA 11. termination site • RNA 12. RNA polymerase • Nucleotide 13. transcription factors • Nitrogenous bases 14. mRNA, rRNA, tRNA • Base pairing rules 15. intron • Replication 16. exon • Helicase 17. codon: start, stop, am.acid • DNA polymerase 18. anticodon • Transcription 19. ribosome • Promoter 20. P site, A site

37. Review • 4 major sections to this test: • 1. DNA structure • Nucleotides • Sugar, phosphate, nitrogenous base • Nitrogenous bases: • adenine, cytosine, guanine, thymine (uracil) • 2. DNA replication • Helicase, DNA polymerase • 3. DNA transcription • DNA to RNA • 4. DNA translation • RNA to protein

38. Review • Transcribe and translate the top strand of the DNA sequence below. Detail the steps and events in each process; including decoding the order of the polypeptide sequence • TACGGACGCTTGAGCCCGAAAGAAGGGCTCGTATTTCATATC • ATGCCTGCGAACTCGGGCTTTCTTCCCGAGCATAAAGTATAG