Patenting Biomarker Inventions

1. Patenting Biomarker Inventions

2. Technology Areas Gene Expression Analysis E.g., sequence specific probes, chip hybridization, sequence specific amplification, differential display, etc. Protein Arrays E.g., antibody chip, 2-D gel, antigen chip (endogenous Abs), etc. Genomic Analysis (individual/subpopulation variation) E.g., SNP, VNTR, STR, RFLP etc.

3. Examples of Discoveries Marker for a present disease state E.g., cancer marker (P53, P21, PSA, CA125, etc.) Causal mutation Surrogate marker (e.g., marker in linkage disequilibrium with causal mutation; expression of surrogate is determined by causal mutation, etc.) Predictor for a future disease state E.g., predisposing mutation, genotype, etc. Surrogate end point marker E.g., responsiveness to drug therapy Expression of particular protein/peptide/mRNA Levels of metabolite, cytokine, hormone, cell type, etc.

4. Types of Claims �Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefore subject to the conditions and requirements of this title.� [35 U.S.C. �101] - claims to process (method), machine (apparatus), manufacture or composition

5. Barriers to Patentability �Product of Nature� doctrine Utility Requirement Prior Art Lack of novelty Obviousness Other statutory bars (public use; prior invention by another; sale/offer for sale � but not licensing) Section 112 Enablement Written description Best mode requirement

6. Product of Nature Doctrine Can�t patent things that exist in nature (e.g., species of plant or animal, type of rock, etc.) However, �isolated� (purified) nucleic acids, proteins, eukaryotic cells, etc. do not exist in nature Transgenic cells, animals, plants, etc. also do not exist in nature

7. Utility Requirement Inventions in the biotech area must have a �real world� use in order to be patentable Can�t patent a protein or nucleic acid sequence unless there is a plausible use for it E.g., use of EST sequence as a probe in order to clone a complete gene is not a �real world� use under the PTO guidelines Typically, in order to patent a protein/nucleic acid sequence, must know something about function of gene/protein Use as diagnostic/prognostic/drug responsiveness/surrogate end point marker are all �real world� uses

8. Anticipation (lack of novelty) A single prior art publication discloses each element of the claimed invention �Prior art� is anything that was publicly known before patent application filing date (priority date) Inventor�s own publications can count as prior art against a later-filed patent application The standards for a �public� disclosure are fairly low (reasonably accessible to person interested in field of invention)

9. Examples of publications  A dissertation filed in a university or departmental library A published abstract A poster or slide show presented at a national/regional/local meeting A departmental seminar A funded federal grant application (Freedom of Information Act) A website pre-meeting compilation of abstracts A publication, including pre-printing availability on a website A published patent application or a patent application laid open for inspection A disclosure to a third party without confidentiality obligation

10. Obviousness Even if a single prior art publication does not disclose each element of a claimed invention, if two or more publications can be combined to disclose all elements of the invention, then they may preclude patentability due to obviousness If the differences between what was publicly known in the field and the elements of the claimed invention are insubstantial, this may also preclude patentability E.g., performing a previously known technique at a slightly different temperature, pH, etc. E.g., performing PCR analysis on a known cancer marker that had previously been examined only by RFLP Use of a previously characterized prostate cancer marker as a diagnostic marker for testicular cancer may or may not be considered obvious

11. Enablement Disclosure of patent application, combined with general knowledge in the field, must enable another skilled worker in the field to make and use the claimed invention without �undue experimentation� Routine experimentation is OK Must enable full scope of the patent claims A patent that disclosed the DNA sequence of rat insulin and generally discussed methods for cloning homologous sequences from other species did not enable a human insulin sequence The fact that a procedure/marker works in one kind of cancer doesn�t mean you have enabled it for all types of cancer Biotechnology as PTO�s favorite example of an �unpredictable art� higher standards for enablement and written description

12. Written Description Requirement Disclosure in patent application must be sufficient so that skilled worker in field, reading the application, would conclude that the inventor was in possession of the claimed invention as of application filing date University of Rochester v. G.D. Searle, Monsanto, Pharmacia & Pfizer Issued patent claimed COX2 inhibitors and described a method for preparing transgenic cells containing COX2 protein and screening compounds for COX2 inhibition, but disclosed no actual COX2 inhibitors Patent was found invalid for lack of written description A separate patent that claimed the screening method was not invalidated

13. Best Mode Requirement A patent applicant must describe best way known (or believed) to perform make and use claimed invention Can�t �hide the ball� and still try to claim a 20 year monopoly on patented subject matter (quid pro quo)

14. Consequences for Biomarker Patent Applications Composition claims to nucleic acid/protein sequences of use as markers may be anticipated (GenBank, EMBL, human genome project data, etc.) Example: you discover that a protein (of sequence = SEQ ID NO:1) is overexpressed in cancer cells and/or is a surrogate end point marker for drug response, etc. SEQ ID NO:1 has already been published as a putative translation product of a gene, even though it was not previously associated with cancer The publication of the sequence would preclude patenting a composition comprising a protein of SEQ ID NO:1 Under US patent law, composition claims are not limited by the intended use of the composition However, if the DNA sequence had been published, but it was not known that it encoded a protein, then composition claims to the protein would likely be allowed Also, if association with cancer was not previously known, you can still claim methods of use for detecting cancer and/or as surrogate end point

15. Publication before Patent Application May Result in Loss of Patent Rights Immediate loss of patent rights in most foreign countries In US, 12-month window to file patent application after publication Usually, inventor�s own publications are the worst prior art Last sentence of abstract/poster/talk may support obviousness rejection

16. Example of Premature Publication A screening assay comparing leukemia and normal cell lines identifies a marker overexpressed in leukemia cells. No clinical data is available on whether marker is found in blood of individuals with leukemia; is correlated with disease progression; or is decreased in response to treatment with anti-cancer compounds. Preliminary results are presented at a meeting, the abstract states: �Although the present results indicate that marker X may be of use for diagnosis or prognosis of leukaemia or as a surrogate marker for therapeutic response to anti-leukemia agents, further studies are required in order to validate this marker in human cancer.� Likely to support obviousness rejection of later filed patent application with clinical data

17. Enablement/Written Description Problems with Preliminary Data A patent application claiming use of a biomarker for diagnosis or prognosis of cancer or as surrogate marker for therapeutic response, based only on cell line data with no clinical support, may be rejected for lack of enablement and/or written description support. What is the solution?

18. File Patent Applications in Stages A provisional US patent application may be filed before publishing preliminary results on cell line data Good for 12 months, never examined, can not result in issued patent Protects against inventor�s public disclosure of preliminary data Within 12 months, need to filed regular US/foreign patent application with any supporting clinical data Data acquired after 12 month period may be filed as a supporting declaration or a continuation-in-part patent application

19. Process Claims Examples 1. A method of [detecting a disease state/predicting susceptibility or resistance to a disease state] comprising a) obtaining a sample from a subject; and b) testing the sample for the [presence/concentration/increase/decrease] of marker X A method of [detecting response to a drug/predicting responsiveness to a drug] comprising: a) treating a subject with compound Y; and b) determining the [presence/concentration/increase/decrease] of marker X.

20. Composition Claims Examples 1. An isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3. SEQ ID NO:1 = AATGCGACGTAATTTGCAGCAG SEQ ID NO:2 = AATGCGACGTCATTTGCAGCAG SEQ ID NO:3 = CTAGCAGGCCTAGGGCTAGGCAAT An isolated protein comprising a sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2. An expression vector comprising an isolated nucleic acid selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3. A cell line transformed with an expression vector comprising an isolated nucleic acid selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

21. Apparatus Claims Examples 1. An apparatus comprising a) a protein chip array; and b) two or more antibodies attached to the array, said antibodies selected from the group consisting of MAb1, Mab2, Mab3, Mab4, Mab5 and Mab6. 2. The apparatus of claim 1, further comprising a spectrophotometer designed to detect fluorescence emissions from the protein array chip.