180 likes | 197 Views
Our team aims to recombine the desired Lignin Peroxidase gene from White Rot into E. Coli, allowing the bacteria to break down phenol in phenolic resin. By utilizing a specific protocol for gene manipulation, we plan to transfer DNA from White Rot into E. Coli and monitor the offspring's ability to degrade phenol resin, a challenging plastic compound.
E N D
Remediation of Phenol Resin Using White Rot Lignin Peroxidase in E. Coli Lorena Christensen Michelle Fretheim Gabe Martin
The Problem with Plastics • Our team was formed out of an interest in the possibility of the breakdown of plastics. There are numerous products and multiple types of plastics, all of which prove difficult if not impossible to degrade over time. • Online research using www.ncbi.nlm.nih.gov and Google scholar into possible candidates for remediation of plastic yielded a fungus called Phanerochaete chrysosporium, common name White Rot. It is capable of degrading phenol (Gusse et al, 1).
The Goal • To recombine desired Lignin Peroxidase gene from White rot (Accession # EF644562 on ncbi.nlm.nih.gov) into E. Coli and have offspring of bacteria display ability to break down phenol. -- Lignin peroxidase decomposes phenolic resin, a structure of phenol and formaldehyde (Gusse et al).
Transferring DNA of white rot into E. coli and then monitoring offspring ability to decompose phenol resin is completely new. The lignin peroxidase has been previously placed into E. coli but we didn't locate any instances of testing the offspring organism's abilities to break down phenol itself. How this is new...
Plan of Action Obtain specimen of white rot from Professor Bumpus in form of mycelium. Use specific protocol for removal of DNA from mycelium per Weiland. (http://www.fgsc.net/fgn44/weiland.html)
After amplification of gene of interest with PCR, will need to build forward and reverse primers. Five introns in the gene will need to be circumvented.
Join 1-9, 62-118, 180-436, 496-574, 628-753; the rest are introns. BLACK = EXON, ORANGE = COMPLEMENT (3’-5’), BLUE = REVERSE COMPLEMENT (5’-3’) # 1 ccttcgtat ggaagcata atacgaagg Gene of interest exons:coding, complement, reverse complemtent
#2 ggtcttcca cgactccatc gctatctcgc ccaagcttca gtcgcagggc aagtttgg ccagaaggt gctgaggtag cgatagagcg ggttcgaagt cagcgtcccg ttcaaacc ccaaactt gccctgcgac tgaagcttgg gcgagatagc gatggagtcg tggaagacc #3 c ggcggcggcg cggacggctc gatcatcacc ttctcctcga tcgagaccac gtaccacccg aacatcggcc tcgacgaggt cgtcgccatc cagaagccgt tcatcgcgaa gcacggcgtc acgcccggcg acttcatcgc gttcgccggt gccgtcggcg tgagcaactg cccgggcgcg ccgcagatgc agttcttcct cggccgcccc gaggcgacgc aggctgcccc cgacggtctc gtgcccgagc ccttcc g ccgccgccgc gcctgccgag ctagtagtgg aagaggagct agctctggtg catggtgggc ttgtagccgg agctgctcca gcagcggtag gtcttcggca agtagcgctt cgtgccgcag tgcgggccgc tgaagtagcg caagcggcca cggcagccgc actcgttgac gggcccgcgc ggcgtctacg tcaagaagga gccggcgggg ctccgctgcg tccgacgggg gctgccagag cacgggctcg ggaagg ggaagg gctcgggcac gagaccgtcg ggggcagcct gcgtcgcctc ggggcggccg aggaagaact gcatctgcgg cgcgcccggg cagttgctca cgccgacggc accggcgaac gcgatgaagt cgccgggcgt gacgccgtgc ttcgcgatga acggcttctg gatggcgacg acctcgtcga ggccgatgtt cgggtggtac gtggtctcga tcgaggagaa ggtgatgatc gagccgtccg cgccgccgcc g
#4 acacc atcgatcagg ttctcgctcg catgcttgat gctggcggct tcgacgagat cgagactgtc tggctgctct ctgc tgtgg tagctagtcc aagagcgagc gtacgaacta cgaccgccga agctgctcta gctctgacag accgacgaga gacg gcag agagcagcca gacagtctcg atctcgtcga agccgccagc atcaagcatg cgagcgagaa cctgatcgat ggtgt #5 cca ctccatcgcg gctgcgaacg acgtcgaccc gaccatctcc ggcctgccgt tcgactccac ccctggccag ttcgactccc agttcttcgt cgagacgcag ctccgcggta ccgcattccc tgg ggt gaggtagcgc cgacgcttgc tgcagctggg ctggtagagg ccggacggca agctgaggtg gggaccggtc aagctgaggg tcaagaagcagctctgcgtc gaggcgccat ggcgtaaggg acc cca gggaatgcgg taccgcggag ctgcgtctcg acgaagaact gggagtcgaa ctggccaggg gtggagtcga acggcaggcc ggagatggtc gggtcgacgt cgttcgcagc cgcgatggag tgg #6 caa gaccggcatc cagggcaccg tcatgtcccc gctcaagggc gagatgcgtc tgcagacgga ccacttgttc gcgcgcgact cgcgcacggc g gtt ctggccgtag gtcccgtggc agtacagggg cgagttcccg ctctacgcag acgtctgcct ggtgaacaag cgcgcgctga gcgcgtgccgc c gccgtgcgcg agtcgcgcgc gaacaagtgg tccgtctgca gacgcatctc gcccttgagc ggggacatga cggtgccctg gatgccggtc ttg
In order to avoid the numerous introns we will build oligonucleotides for desired exon segments our gene: 1-9, 62-118, 180-436, 496-574, 628-753; the rest are introns: *1-9 connected to 62-118 with 16-base overlaps (10-61 and 119-179 are introns) 3’Ccttcgtatccagaaggtgctgagg caagcttcagtcgcagggcaagtttgg 5’Ggtcttccacgactccatcgctatctcgccgttcgaagtcagcgtc *180-436 too big for this method (437-496 is an intron) *496-574 oligos connected with 16-base overlaps (575-627 is an intron) 3’Acaccatcgatcaggttctcgctcgctacgatctacgaccgc agatcgagactgtctggctgctctctgc 5’Atgcttgatgctggcggcttcgacgtctagctctgacagac
*628-753 oligos connected with 16-base overlaps 3’Ccactccatcgcggctgcgaacgacgagctgggctggtagag ttcgactccacccctggccagttc... 5’tcgacccgaccatctccggcctgccgaagctgaggtggggac 3’ctgagggtcaagaagc gctccgcggtaccgcattccctgg 5’gactcccagttcttcgtcgagacgcacgaggcgccatggcgt *808-901 oligos connected with 16-base overlaps 3’Attgcagcaagaccggcatccacccgtggcagtacagg agggccagatgcgtctgcagacg... 5’gggcaccgtcatgtccccgctcatcccggtctacgcaga 3’ctggtgaacaagcgcg 5’gaccacttgttcgcgcgcgactcgcgcacggcg
To verify introns were successfully removed, we will add restriction enzymes to DNA obtained from PCR amplification, run gels and check fragment sizes. Restriction enzymes used for the project are ECOR I, Xbai, Spe I and PST I. Verified that these would not cut our desired sequence in any undesired areas using the NEB cutter tool.
The sequence used will be built into a biobrick, with required format E-X-Part of Interest-S-P (Schwekendiek, 3). Will select vector for procedure per guidelines of partsregistry.org in order to submit created items.
Will follow general protocol for recombination as follows: 1. Use appropriate restriction enzymes to cut vector and gene of interest. 2. Will ligate into appropriate plasmid (or other recommended vector). 3. Will then introduce into E. coli
The next step will be the observation of traits in offspring and testing for presence of desired gene. In order to properly test for lignin peroxidase in offspring, will need to subject them to media limited in Carbon, Nitrogen and sulfur in order to remove repression of LiP production.
Phenol placed on such limited substrate will show discoloration from presence of the LiP in the offspring if the transfer is successful.
If this project fails due to death of created offspring during breakdown of the phenol resin, there is currently no other organism capable of the desired results so there is nothing we can replace it with. We could attempt to find the gene in the parent fungus DNA that allows it to resist the toxicity of the phenol and transfer that to the E. coli offspring and retry decomposition of the phenol resin. The Backup Plan
http://pubs.acs.org/doi/pdfplus/10.1021/es060408h http://www.fgsc.net/fgn44/weiland.html Lecture 09/2010 Schwekendiek References