cornell-boyle
Uploaded by
40 SLIDES
580 VIEWS
400LIKES

Complex (Biological) Networks

DESCRIPTION

Complex (Biological) Networks. Analyzing Metabolic Networks. Elhanan Borenstein Spring 2010. Some slides are based on slides from courses given by Roded Sharan and Tomer Shlomi. Metabolism.

1 / 40

Download Presentation

Complex (Biological) Networks

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Complex (Biological) Networks Analyzing Metabolic Networks Elhanan Borenstein Spring 2010 Some slides are based on slides from courses given by Roded Sharan and Tomer Shlomi

  2. Metabolism “Metabolism is the process involved in the maintenance of life. It is comprised of a vast repertoire of enzymatic reactions and transport processes used to convert thousands of organic compounds into the various molecules necessary to support cellular life” Schilling et al. 2000

  3. Why study metabolism? (II) • It’s the essence of life (and maybe its origins) • Tremendous importance in Medicine • Inborn errors of metabolism cause acute symptoms • Metabolic diseases (obesity, diabetes) are on the rise (and are major sources of morbidity and mortality) • Metabolic enzymes becoming viable drug targets • Bioengineering applications • Design strains for production of biological products • Generation of bio-fuels • The best understood of all cellular networks

  4. Metabolites & Biochemical Reactions • Metabolite: an organic substance • Sugars (e.g., glucose, galactose, lactose) • Carbohydrates (e.g., glycogen, glucan) • Amino-acids (e.g., histidine, proline, methionine) • Nucleotides (e.g., cytosine, guanine) • Lipids • Chemical energy carriers (e.g., ATP, NADH) • Atoms (e.g., oxygen, hydrogen) • Biochemical reaction: the process in which one or more substrate molecules are converted (usually with the help of an enzyme) to produce molecules

  5. Pathways • EcoCyc describes 131 pathways • Pathways vary in length from a single step to 16 steps (ave 5.4) • But ... no precise biological definition and partitioning of the metabolic network into pathways is somehow arbitrary Ouzonis, Karp, Genome Res. 10, 568 (2000)

  6. http://www.genome.jp/kegg/pathway/map/map01100.html From Pathways to a Network

  7. ModelsofMetabolism (and Metabolic Networks)

  8. Metabolic Network Models required data/accuracy /complexity abstraction/scale Approximate Kinetic models • Conventional models • Boolean models • Discrete models • Bayesian models • Topological analysis • Degree distribution • Motifs • Modularity • Reverse ecology • Kinetic models • Dynamic system(differential eq’s) • Requires unknown data constants and concentrations • Constraint-based • CB-Models • Flux Balance Analysis • Extreme Pathways • Growth/KO effects 8

  9. Reverse Ecology

  10. Reconstructing Metabolic Networks A E D C B Describing the chemical reactions in the cell and the compounds being consumed and produced Fructose + Glucose => Sucrose atgaaaaccgtcgtttttgcctaccacgatatgggatgcctcggtatg • Simple Representation • Nodes=compounds • Edges=reactions • Topology based • Static • Incomplete data • Noise • Large-scale • Simple directed graphs Fructose Glucose Sucrose

  11. Metabolic Network (E.Coli)

  12. Environments from Networks • Can the structure/topology of metabolic networks be used to obtain insights into the ecology in which species evolved/prevail? Environment & Ecology inference System Topology& Structure Reverse Ecology ofMetabolic Environments • (Borenstein, et al.PNAS, 2008)

  13. Seed Sets& Metabolic Environments set of exogenously acquired compounds(seed set) proxy for the environment(operational definition) Metabolic Network Boundaries 6 3 1 Environment 7 Seed set:a minimal subset of the compounds that cannot be synthesized from other compounds and whose existence permits the synthesis of all other compounds in the network. 3 2 4 9 8 0 5 • (Borenstein, et al.PNAS, 2008)

  14. Identifying Seed Compounds:A Simple Synthetic Example 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  15. Identifying Seed Compounds:Strongly Connected Components (SCC) 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  16. Kosaraju’s algorithm for SCC Decomposition • Given a graph G: • Run a Depth-First Search (DFS) on G to compute finishing times f[v] for each node v • Calculate the transposed network G (the network G with the direction of every edge reversed) • Run DFS on G, traversing the nodes in decreasing order of f[v] • Each tree in the DFS forest createdby the second DFS run forms a separate SCC 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  17. Identifying Seed Compounds:Strongly Connected Components (SCC) • SCCs are equivalent sets (“seed”-wise) 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  18. Identifying Seed Compounds:Strongly Connected Components (SCC) • Directed Acyclic Graph (DAG) 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  19. Identifying Seed Compounds:Source Components • Candidate seeds are members of source components 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  20. Identifying Seed Compounds:Candidate Seeds 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  21. Identifying Seed Compounds:Seed Confidence Level 15 14 3 6 11 2 7 9 4 8 12 1 5 10 13

  22. Metabolic Network with Seeds

  23. Multi-Species Large-Scale Seed Dataset • 478 species (networks); >2200 compounds • Seed compounds for each species • Large-scale datasetof predicted metabolic environments 2264 compounds accuracy 79%precision 95%recall 67% 478 species

  24. Applications of Reverse Ecology • Reconstructing ecology-based phylogeny • Predicting ancestral environments • Identifying evolutionary dynamics of networks • Predicting species interaction • Analyzing genetic vs. environmental robustness • Quantifying ecological strategies

  25. Constraint-Based Modeling

  26. Constraint-Based Modeling • Living systems obey physical and chemical laws • These can be used to constrain the space of possible behaviors of the network How often have I said to you that when you have eliminated the impossible, whatever remains, however improbable, must be the truth? – Sherlock Holmes (A Study of Scarlet)

  27. Evolution Under Constraints

  28. Reaction Stoichiometry • Stoichiometry - the quantitative relationships of the reactants and products in reactions 1 Glucose + 1 ATP 1 Glucose-6-Phosphate + 1 ADP

  29. Stoichiometric Matrix S

  30. Stoichiometric Matrix and Fluxes • m: metabolite concentrations vector (mol/mg) • S: stoichiometric matrix • v: reaction rates vector

  31. A Full Model? Not Really A set of Ordinary Differential Equations (ODE) Kinetic parameters Reaction rate equation Requires knowledge of m, f and k!

  32. Constraint-Based Modeling • Assumes a quasi steady-state! • No changes in metabolite concentrations • Metabolite production and consumption rates are equal • No need for info on metabolite concentrations, reaction rate functions, or kinetic parameters

  33. Constraint-Based Modeling • In most cases, S is underdetermined: a subspace of Rn (possible flux distributions) S∙v=0 • Thermodynamic constraints: a convex cone vi > 0 • Capacity constraints: a bounded convex cone vi < vmax

  34. Flux Balance Analysis • But this still leaves a space of solutions • How can we identify plausible solutions within this space? • Optimize for maximum growth rate !!

  35. Flux Balance Analysis

  36. Flux Balance Analysis How do we solve this? Linear Programming

  37. Linear Programming (LP) • Assume the following constraints: • 0<A<60 • 0<B<50 • A+2B<120 • Optimize: • Z=20A+30B

  38. Application of CBM & FBA • Predict metabolic fluxes on various media • Predict growth rate • Predict gene knockout lethality • Characterize solution space • Many more …

  39. Available CBM Metabolic Models Bernhard PalssonUCSD

More Related