To demonstrate understanding after this lesson you should be able to
Download
1 / 24

To demonstrate understanding, after this lesson, you should be able to - PowerPoint PPT Presentation


  • 105 Views
  • Uploaded on

To demonstrate understanding, after this lesson, you should be able to. define mutations explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals recognize point (N-base) mutations (insertions, deletions and substitutions)

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'To demonstrate understanding, after this lesson, you should be able to' - colton-stanley


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
To demonstrate understanding after this lesson you should be able to
To demonstrate understanding, after this lesson, you should be able to

  • define mutations

  • explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals

  • recognize point (N-base) mutations (insertions, deletions and substitutions)

  • recognize chromosomal mutations (deletion, duplication, inversion, insertion, translocation)


I mutations
I. Mutations be able to

  • …are any change in the DNA of an organism.

  • May not have any affect or may cause a major deformation, illness.


I mutations1
I. Mutations be able to

  • …are any change in the DNA of an organism.

  • May not have any affect or may cause a major deformation, illness.


I mutations2
I. Mutations be able to

Any change in DNA is a mutation.

caused by mistakes during…

  • DNA replication of mitosis

  • Transcription

  • meiosis

    Also can be caused by environmental factors like…

  • Radiation

  • Carcinogens


Mutations in reproductive sex cells vs body cells
Mutations in Reproductive (Sex) Cells VS. Body cells be able to

-Mutations in sex cells a.k.a. gametes (sperm and egg cells) can be passed down to a person’s children, but might not affect the parent

-Mutations in body cells cannot be passed on to your children, however, they can cause cancer or other problems



Ii cancer as a result of mutations in body cells1
II. Cancer as a result of mutations in body cells: be able to

Carcinogens- environmental/chemical factors that cause cancer

Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!!


Iii gene mutations
III. Gene Mutations be able to

  • Point Mutation

    • only 1 codon is affected

    • example: “substitution mutation”

      AUC GGA UCC  AUC CGA UCC

      THE FAT CAT WAS MAD

      THE FUT CAT WAS MAD


Iii point mutation
III. Point mutation be able to

mRNA

Normal

Protein

Stop

Replace G with A

Point mutation

mRNA

Protein

Stop


Point mutations in our lives
Point mutations in our lives! be able to

-Sickle cell anemia is a blood disease caused by a SUBSTITUTION point mutation.

-A single nucleotide is changed from “A” to “T” which causes the amino acid to change from glutamic acid to valine:

Amino acids: Thr – Pro – Glu – Glu

Normal: ACT CCT GAG GAG

Sickle cell: ACT CCT GTG GAG

Amino acids: Thr – Pro – Val – Glu


Point mutations in our lives1
Point mutations in our lives! be able to

-People with sickle cell anemia often experience a lot of pain and swelling and have trouble exercising.


Iv more gene mutations
IV. More Gene Mutations be able to

  • Frameshift Mutations –

    • will affect several if not all of the following codons! (MAJOR PROBLEM!)

    • Example: “Deletion” – one base was left out.

      AAU CGA GGA …  AAC GAG GA…

      (What is missing?)

      AAU CGA GGA …  AAC GAG GA…


Iv frameshift mutation
IV. Frameshift mutation be able to

-A frameshift mutation is when one nucleotide is inserted or deleted from the DNA or mRNA strand.

-A frameshift mutation is worse…. WHY???

Ex: DNA TACTTCAAACCGCGTAACATT

mRNA

Protein



To demonstrate understanding after this lesson you should be able to

THE FAT CAT WAS MAD… mutation.

THE FAC ATW ASM AD…

Deletions cause a shift in the codons…just like leaving a letter out, it makes no sense!


Other frameshift mutations
Other Frameshift Mutations: mutation.

  • “Insertion” – an extra base is added.

    ACC GAU GUC…  ACU CGA UGU C…

    (What was added?)

    ACC GAU GUC…  ACU CGA UGU C…


To demonstrate understanding after this lesson you should be able to

THE FAT CAT WAS MAD mutation.

THE FAD TCA TWA SMA D…

Once again, this makes no sense!


Questions
Questions: mutation.

Is this a substitution mutation or a frameshift mutation?

-It’s a substitution mutation because G was replaced with a T!


Questions1
Questions: mutation.

THE DOG BIT THE CAT

THE DOG BIT THE CAR

Substitution or frameshift?

Substitution!


Questions2
Questions mutation.

THE DOG BIT THE CAT

THE DOB ITT HEC AT

Substitution or frameshift?

Frameshift! The mutated sentence makes no sense (non-sense) and thus the protein will not be made


Chromosome mutations
Chromosome Mutations mutation.

  • …are usually damaging.

  • An entire piece of a chromosome may be deleted, moved or damaged.

  • ALL INFORMATION ON THE AFFECTED SECTION MAY BE LOST OR FOREVER CHANGED (and is useless).


Types of chromosome mutations
Types of Chromosome Mutations mutation.

  • Deletion – the whole chromosome is gone!

  • Duplication – now you have 2 sets of the same stuff.

  • Inversion – one part of a chromosome gets moved to another area on the SAME chromosome.

  • Translocation – a section of a chromosome is stuck on a DIFFERENT chromosome



Summarizing can you
Summarizing Can you… mutation.

  • define mutations

  • explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals

  • recognize point (N-base) mutations (insertions, deletions and substitutions)

  • recognize chromosomal mutations (deletion, duplication, inversion, insertion, translocation)