Base mutations on protein function and phenotypes
Download
1 / 25

Base Mutations on Protein Function and Phenotypes - PowerPoint PPT Presentation


  • 82 Views
  • Uploaded on

Base Mutations on Protein Function and Phenotypes. Polypeptides made up of amino acids Proteins are polypeptides, numerous amino acids. **Notice the “R” group. It’s a group of molecules that determines the amino acid. **Peptide Bond between amino acids. First Recall Proteins------.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Base Mutations on Protein Function and Phenotypes' - clare-hinton


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

First recall proteins

**Notice the “R” group. It’s a group of molecules that determines the amino acid.

**Peptide Bond between amino acids

First Recall Proteins------


Amino acid sequence polypeptide

Human Growth Hormone

Amylase Enzyme

Amino Acid Sequence - Polypeptide



Structural proteins

  • Forms part of cell materials

  • Provides support

    • fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin

    • Collagen, and elastin are examples. Collagens and elastin provide support for connective tissue such as tendons and ligaments.

Structural Proteins


Functional proteins

  • Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism

    • Growth and development

    • Metabolism - how your body gets energy from the foods you eat

    • Sexual function

    • Reproduction

    • Mood

  • Enzymes – catalyze chemical reactions.

    • Example – Amylase is the enzyme that breaks starches in your mouth. Speeds up the rate of digestion.

    • Nearly all biochemical reactions require them!

  • Functional Proteins



    Mistakes can occur

    • Remember that DNA is replicated during the S phase of Interphase of the cell cycle and during Meiosis (the formation of gametes)

    • Mutations may or may not change the function of a protein

      • May change phenotype or how a gene is expressed

        • Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype

    Mistakes Can Occur!!


    Mutations

    ***Errors usually occur during DNA replication and transcription by external agents called mutagens (chemicals, radiation, X-rays etc.)

    ***Some occur randomly and some phenotypes are selected for in nature

    ***Although mutations can cause problems, if it weren’t for mutations, we wouldn’t have new genes such as those for green eyes

    Mutations


    Fixing errors

    “Fixing” Errors


    Mutations change a dna sequence and may affect a gene

    • May be random or spontaneous. replace those wrongly paired

    • When genes have an error in their DNA code, they may not work properly, and are said to be "altered" or mutated.

    • DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection

      • Mistakes that occur when a cell copies its DNA in preparation for cell division.

      • Can occur during meiosis (making of sperm, and egg)

      • Changes mRNA codons

    Mutations Change a DNA Sequence and May Affect a Gene



    Base mutations on protein function and phenotypes

    Spontaneous Mutations replace those wrongly paired Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur


    Base mutations on protein function and phenotypes

    Mutated Cells replace those wrongly paired

    • Some mutated cells will be defeated by the body's immune system

    • others may undergo apoptosis, or “cell suicide”.

    • occasionally a cell with mutations slips through proofreading safeguards.

    • When mutations accumulate, the genetic material is so scrambled that the cell no longer acts like a normal, healthy cell.

    • Tumors, mass of cells that have no purpose, may form


    Benign tumors non cancerous

    • Not malignant tumor (cancerous) replace those wrongly paired

    • Does not invade nearby tissue or spread to other parts of the body the way cancer can.

    • But benign tumors can be serious if they press on vital structures such as blood vessels or nerves.

    • Some, such as colon polyps, can become cancerous

    Benign Tumors (non-cancerous)


    Cancerous tumor malignant

    • Abnormal cells grow uncontrolled replace those wrongly paired

    • Invades surrounding tissues

    • Usually capable of producing metastases (spread to other organs)

    • May recur after attempted removal

    • May cause death of the host unless adequately treated

    Cancerous Tumor (malignant)


    Mutations and reproduction

    **Mutations replace those wrongly pairedcan occur during meiosis, the making of sperm or egg and can be passed along to offspring

    **Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm formation

    **The mutation may produce a new trait (good OR bad)

    .

    Mutations and Reproduction


    Types of base mutations

    ** Point mutations, base substitution, affects a single base replace those wrongly paired

    **Frameshift – Addition or deletion of a base – Affects entire protein

    Types of Base Mutations


    Base mutations on protein function and phenotypes

    Base Pair Substitution – AKA Point Mutation replace those wrongly paired


    Point mutations

    • Affects a single base replace those wrongly pairedand change the codon

    • May or may not affect the amino acid

      • Sometimes if the third base of the codon changes, the amino acid may stay the same!

      • UCU

      • UCC

      • UCA

      • UCG

    ALL code for Ser

    Point Mutations


    Base mutations on protein function and phenotypes

    TACCAGGATTAA replace those wrongly pairedCATGGAAGTGTAATC

    DNA

    AUGGUCCUAAUUGUACCUUCACAUUAG

    mRNA

    Met

    Met

    Val

    Val

    Leu

    Leu

    Ile

    Ile

    Val

    Pro

    Pro

    Ser

    Ser

    His

    His

    (STOP)

    (STOP)

    Leu

    Base Substitution MAY or MAY NOT Change the Protein

    What if the C was substituted with an A ?????

    TACCAGGATTAA

    AATGGAAGTGTAATC DNA

    AUGGUCCUAAUU

    UUACCUUCACAUUAG mRNA

    REMEMBER if the 3rd base is changed, it may not change the protein!


    Base substitution example

    Sickle Cell Anemia – red blood cells have a protein on their surgface called hemoglobin that carry oxygen. Patients with this affliction have misshaped (sickle-shaped) red blood cells and cannot carry enough oxygen

    **Notice the DNA sequence below.. A is substituted for a T

    Base Substitution Example


    Frameshift mutation

    Frameshift Mutation


    Base mutations on protein function and phenotypes

    Phe of bases left or right, changing the amino acids affecting the whole protein. It won’t function properly

    Met

    Met

    Val

    Val

    Asp

    Leu

    Leu

    Ile

    Ile

    Val

    Thr

    Pro

    Ser

    His

    (STOP)

    Thr

    Leu Extra Base

    Frame-Shift Addition

    Example: Addition of a T beside of the C... shifts the entire protein over to the right– changes ENTIRE PROTEIN – There is NO STOP CODON!!

    DNA

    DNA

    mRNA

    mRNA

    TACCAGGATTAACATGGAAGTGTAATC

    AUGGUCCUAAUUGUACCUUCACAUUAG

    TACCAGGATTAA

    CTATGGAAGTGTAATC…

    GAUACCUUCACAUUAG…

    AUG GUC CUA AUU


    Base mutations on protein function and phenotypes

    Ile of bases left or right, changing the amino acids affecting the whole protein. It won’t function properly

    His

    Met

    Met

    Val

    Val

    Leu

    Thr

    Leu

    Ile

    Ile

    Val

    Pro

    Leu

    Ser

    His

    (STOP)

    Ser or Arg

    Frameshift Deletion

    Example: Deletion of the C... shifts the entire protein over to the Left– changes ENTIRE PROTEIN – There is NO STOP CODON!!

    DNA

    DNA

    mRNA

    mRNA

    TACCAGGATTAACATGGAAGTGTAATC

    AUGGUCCUAAUUGUACCUUCACAUUAG

    TACCAGGATTAA

    ATGGAAGTGTAATC…

    UACCUUCACAUUAG…

    AUG GUC CUA AUU