additional file 4 microarray probes encompassing sco6832 sco6833 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Additional File 4: Microarray probes encompassing SCO6832-SCO6833 PowerPoint Presentation
Download Presentation
Additional File 4: Microarray probes encompassing SCO6832-SCO6833

Loading in 2 Seconds...

play fullscreen
1 / 1

Additional File 4: Microarray probes encompassing SCO6832-SCO6833 - PowerPoint PPT Presentation


  • 119 Views
  • Uploaded on

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Additional File 4: Microarray probes encompassing SCO6832-SCO6833' - claire-pittman


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
additional file 4 microarray probes encompassing sco6832 sco6833

ATGGCGCGCGAGTCGGCCAGTGCTCGGACCAGCGAGTCGGGGCTGCCCATCGAACCGGTCTACGGGCCCGACGCCCTGGCGGACTGGGACGCGGCCGAGAAGCTGGGCGAGCCCGGGAAGTACCCCTTCACCCGGGGCGTCTACCCGTCGATGTACACCGGCCGGCCGTGGACGATGCGCCAGTACGCCGGTTTCGGCACGGCCACGGAGTCCAACGCCCGCTACAAGCAGCTGATCGCCAACGGCACCATGGGCCTGTCGGTCGCCTTCGACCTGCCCACCCAGATGGGCCACGACTCCGACGCGCCGATCGCGAGCGGCGAGGTCGGCAAGGTCGGCGTCGCCATCGACTCCATCGACGACATGCGGGTGCTGTTCGGCGGGATCCCGCTGGACAAGGTCTCCACGTCGATGACGATCAACGCCCCTGCCTCGCTGCTGCTCCTGCTCTACCAACTCGTCGCCGAGGAGCAGGGCGTGAGCGCCGACAAGCTCACCGGCACGATCCAGAACGACGTGCTGAAGGAGTACATCGCGCGCGGGACGTACATCTTCCCGCCGAAGCCGTCGCTGCGCCTGATCGCGGACATCTTCAAGTACTGCCGGGCCGAGATCCCGAAGTGGAACACCATCTCGATCTCCGGCTACCACATGGCCGAGGCGGGCGCGTCTCCCGCGCAGGAGATCGCGTTCACCCTCGCGGACGGCATCGAGTACGTGCGCACCGCGGTCGCGGCCGGCATGGACGTGGACGACTTCGCGCCCCGCCTGTCCTTCTTCTTCGTGGCCCGCACGACGATCCTGGAGGAGGTCGCCAAGTTCCGCGCGGCCCGCCGGATCTGGGCCCGGGTGATGAAGGAGGAGTTCGGCGCGAAGAACCCCAAGTCGCTGATGCTGCGCTTCCACACCCAGACGGCGGGCGTGCAGCTGACCGCCCAGCAGCCCGAGGTGAACCTGGTCCGCGTCGCCGTGCAGGGTCTCGGCGCGGTCCTCGGCGGCACGCAGTCGCTGCACACCAACTCCTTCGACGAGGCCATCGCGCTGCCCACCGACAAGTCCGCGCGCCTGGCCCTGCGCACCCAGCAGGTGCTCGCCTACGAGACGGACGTGACGGCGACCGTCGACCCCTTCGCCGGCTCCTACGTCGTCGAGCGGATGACCGACGACGTCGAGGCGGCGGCGCTGGAGCTGATGGGCAAGGTGGAGGACCTCGGCGGCGCGGTCAACGCCATCGAGCACGGCTTCCAGAAGAACGAGATCGAGCGCTCCGCCTACCGCATCGCCCAGGAGACCGACTCCGGCGAGCGGGTCGTGGTCGGCGTCAACCGCTTCCAGCTCGACGAGGAGGAGCCCTACGAGCCGCTGCGCGTCGACCCGGCCATCGAGGCCCAGCAGGCCGAGCGGCTGGCCAAGCTCCGCGCCGAGCGCGACCAGCAGGCGGTGGACTCGGCACTGGCGGCCCTGAGGAAGGCCGCCGAGGGCGAGGACAACGTCCTGTACCCGATGAAGGACGCGCTGCGGGCCCGGGCGACGGTGGGCGAGGTGTGCAACGCGCTGCGGGAGGTCTGGGGGACGTACGTGCCCTCCGATCTCTAAGACGAGTGGTCCAATTTGCCTTGCTGAGTGAGGAGTTCATTTCATGCGGCAGCTACCGATGCGAGTGGTTGTGGCCAAACCTGGCCTCGACGGTCACGATCGTGGAGCGAAGGTCGTCGCACGAGCTTTGCGTGATGCCGGAGTGGAAGTCATCTACACGGGTCTGCACCAGACGCCGGCGCAGATCGTCGCCACAGCAATCCAGGAAGACGCTGACGGCATCGGACTATCTGTGCTGTCCGGAGCGCACATGACCGCGTTCACGGAGGTTATGAAGCTGATCCAGCTGGAGGAGGCGACGAACATTATCGTCTTCGGCGGAGGCATCATTCCCGATGACGATGCTGCGAACCTCCTCGAAGGGGGAGTCGCGGCCCTATTTACACCGGGGACGTCGATGGCGACGGTGGTCGATTGGGTGACGAATCATGTGGGTGGACGGCGAACCGGCCGGGTCTTGGCGCAGCCTGTTCCCCATAGCGCGCAGGCTGCTCCTGCTGGGCCCTTCCAACGAAGCCGTTGAATGGCGCGCGAGTCGGCCAGTGCTCGGACCAGCGAGTCGGGGCTGCCCATCGAACCGGTCTACGGGCCCGACGCCCTGGCGGACTGGGACGCGGCCGAGAAGCTGGGCGAGCCCGGGAAGTACCCCTTCACCCGGGGCGTCTACCCGTCGATGTACACCGGCCGGCCGTGGACGATGCGCCAGTACGCCGGTTTCGGCACGGCCACGGAGTCCAACGCCCGCTACAAGCAGCTGATCGCCAACGGCACCATGGGCCTGTCGGTCGCCTTCGACCTGCCCACCCAGATGGGCCACGACTCCGACGCGCCGATCGCGAGCGGCGAGGTCGGCAAGGTCGGCGTCGCCATCGACTCCATCGACGACATGCGGGTGCTGTTCGGCGGGATCCCGCTGGACAAGGTCTCCACGTCGATGACGATCAACGCCCCTGCCTCGCTGCTGCTCCTGCTCTACCAACTCGTCGCCGAGGAGCAGGGCGTGAGCGCCGACAAGCTCACCGGCACGATCCAGAACGACGTGCTGAAGGAGTACATCGCGCGCGGGACGTACATCTTCCCGCCGAAGCCGTCGCTGCGCCTGATCGCGGACATCTTCAAGTACTGCCGGGCCGAGATCCCGAAGTGGAACACCATCTCGATCTCCGGCTACCACATGGCCGAGGCGGGCGCGTCTCCCGCGCAGGAGATCGCGTTCACCCTCGCGGACGGCATCGAGTACGTGCGCACCGCGGTCGCGGCCGGCATGGACGTGGACGACTTCGCGCCCCGCCTGTCCTTCTTCTTCGTGGCCCGCACGACGATCCTGGAGGAGGTCGCCAAGTTCCGCGCGGCCCGCCGGATCTGGGCCCGGGTGATGAAGGAGGAGTTCGGCGCGAAGAACCCCAAGTCGCTGATGCTGCGCTTCCACACCCAGACGGCGGGCGTGCAGCTGACCGCCCAGCAGCCCGAGGTGAACCTGGTCCGCGTCGCCGTGCAGGGTCTCGGCGCGGTCCTCGGCGGCACGCAGTCGCTGCACACCAACTCCTTCGACGAGGCCATCGCGCTGCCCACCGACAAGTCCGCGCGCCTGGCCCTGCGCACCCAGCAGGTGCTCGCCTACGAGACGGACGTGACGGCGACCGTCGACCCCTTCGCCGGCTCCTACGTCGTCGAGCGGATGACCGACGACGTCGAGGCGGCGGCGCTGGAGCTGATGGGCAAGGTGGAGGACCTCGGCGGCGCGGTCAACGCCATCGAGCACGGCTTCCAGAAGAACGAGATCGAGCGCTCCGCCTACCGCATCGCCCAGGAGACCGACTCCGGCGAGCGGGTCGTGGTCGGCGTCAACCGCTTCCAGCTCGACGAGGAGGAGCCCTACGAGCCGCTGCGCGTCGACCCGGCCATCGAGGCCCAGCAGGCCGAGCGGCTGGCCAAGCTCCGCGCCGAGCGCGACCAGCAGGCGGTGGACTCGGCACTGGCGGCCCTGAGGAAGGCCGCCGAGGGCGAGGACAACGTCCTGTACCCGATGAAGGACGCGCTGCGGGCCCGGGCGACGGTGGGCGAGGTGTGCAACGCGCTGCGGGAGGTCTGGGGGACGTACGTGCCCTCCGATCTCTAAGACGAGTGGTCCAATTTGCCTTGCTGAGTGAGGAGTTCATTTCATGCGGCAGCTACCGATGCGAGTGGTTGTGGCCAAACCTGGCCTCGACGGTCACGATCGTGGAGCGAAGGTCGTCGCACGAGCTTTGCGTGATGCCGGAGTGGAAGTCATCTACACGGGTCTGCACCAGACGCCGGCGCAGATCGTCGCCACAGCAATCCAGGAAGACGCTGACGGCATCGGACTATCTGTGCTGTCCGGAGCGCACATGACCGCGTTCACGGAGGTTATGAAGCTGATCCAGCTGGAGGAGGCGACGAACATTATCGTCTTCGGCGGAGGCATCATTCCCGATGACGATGCTGCGAACCTCCTCGAAGGGGGAGTCGCGGCCCTATTTACACCGGGGACGTCGATGGCGACGGTGGTCGATTGGGTGACGAATCATGTGGGTGGACGGCGAACCGGCCGGGTCTTGGCGCAGCCTGTTCCCCATAGCGCGCAGGCTGCTCCTGCTGGGCCCTTCCAACGAAGCCGTTGA

SCO6832

Additional File 4: Microarray probes encompassing SCO6832-SCO6833

SCO6833