slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid PowerPoint Presentation
Download Presentation
His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid

Loading in 2 Seconds...

play fullscreen
1 / 7

His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid - PowerPoint PPT Presentation


  • 153 Views
  • Uploaded on

His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid Study for rv3676 -homolog in Mycobacterium sp. strain JC1 1. Primer extension 2. Mutagenesis CO oxidizer Pseudonocaridia was deposit in KCCM Pandoraea 16s rDNA sequencing Tsukamurella

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
    Presentation Transcript
    1. His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid Study for rv3676-homolog in Mycobacterium sp. strain JC1 1. Primer extension 2. Mutagenesis CO oxidizer Pseudonocaridia was deposit in KCCM Pandoraea 16s rDNA sequencing Tsukamurella CO-DH expression in M. tuberculosis ? Northern blot or Western blot Confirmation of transcription level in Mycobacterium sp. strain JC1 (under SNP) cutBCA, orf1-6… Confirmation of transcription level in Mycobacterium smegmatis (under SNP) CO-DH expression in Mycobacterium smegmatis

    2. CutR expression pMal C2X vector 이용 -> sequencing 의뢰 Searching the anti-tuberculosis drug from natural compound 흰쌀, 지골피, 측백잎, 황경피나무껍질, 마늘, 고삼, 백급, 대추, 의이인 분자설계연구소 200 개의 compound test. test 완료. XDH inhibitor Allopurinol, oxypurinol, BOF 4272, FYX, Y-700, TEI-6720 CO-DH purification from Mycobacterium smegmatis Mutagenesis for das gene Searching the single crossover mutant candidates CO-DH expression in Mycobacterium sp. strain JC1 mod mutant

    3. Paper work • Mycobacterium sp. strain JC1 CO-DH cloning Cosmid library Primer extension 2. Mycobacterium sp. strain JC1 RubisCO cloning Library screening method… Mycobacterium smegmatis mc2-155 No cbbLS gene in database has key enzymes for reverse TCA cycle PCR product for cbbLS gene in Mycobacterium smegmatis mc2-155 wild type, orf2- mutant, and orf4- mutant. Southern blot for cbbL gene

    4. Confirm : #41, 49, 57 61, 70, 77, 81, 84, 92, 94, 97, 112, 114, 119, 150 ,151, 152, 161, 169, 174, 176

    5. A B 1 2 3 1 2 3 SMB-CO 507 5.0 427 SMB-MeOH 7.0 8.5 15.6 27.4 5.0 0.8 SMB-glucose 105.6 91.2 34.6 0.29 0.27 0.25 A : CBB staining B : CO-DH activity staining Lane 1 : Mycobacterium sp. strain JC1 wild type Lane 2 : Mycobacterium sp. strain JC1 copy I CO-DH deletion mutant Lane 2 : Mycobacterium sp. strain JC1 copy II CO-DH deletion mutant

    6. IR1 CACGCGCTGAACGTACCCGAGGGCCAGTTAAGCGATTCCTTAAGGGGGGTGTTGAGAGCTCGCTTCGACTGCGTCTACCG GTGCGCGACTTGCATGGGCTCCCGGTCAATTCGCTAAGGAATTCCCCCCACAACTCTCGAGCGAAGCTGACGCAGATGGC TCGCAGACCGCGGTGTCGATCGCGGCTGAGATCATCGCGTGCCAGTGGGGTGGTGGCGGGCGTCCGCTGGCCCAGCTCGG AGCGTCTGGCGCCACAGCTAGCGCCGACTCTAGTAGCGCACGGTCACCCCACCACCGCCCGCAGGCGACCGGGTCGAGCC TGGCCGCATCCATCACGAGTGGGGGTCTGACGTGGGCAAACGCGGCTCCGATTACGGATCAGACCCCGAGTTAAGTGATT ACCGGCGTAGGTAGTGCTCACCCCCAGACTGCACCCGTTTGCGCCGAGGCTAATGCCTAGTCTGGGGCTCAATTCACTAA CCTTAACTCGCTATTGACGCCATCGCGGCGGCAACGGAAACTAGCCACTTCAGCCACGACGTTGTGAGGATGATCACATG GGAATTGAGCGATAACTGCGGTAGCGCCGCCGTTGCCTTTGATCGGTGAAGTCGGTGCTGCAACACTCCTACTAGTGTAC -35 (cutR) -10 (cutR) cutR +1 (cutR) +1 (cutB1) -35 (cutB1) -10 (cutB1) cutB1 CBS IR2 +1 (cutB1) -35 (cutB1) -10 (cutB1)

    7. 3’ G G G G G A A T T C C T T A G 5’ 1 2 T A C G cutB primer extension cutR primer extension 3’ G T T T G C G C C G A 5’ T C G A glucose CO 3’ G G T G A A G T C G 5’