antisense approach to target mdr tuberculosis l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Antisense Approach to Target MDR Tuberculosis PowerPoint Presentation
Download Presentation
Antisense Approach to Target MDR Tuberculosis

Loading in 2 Seconds...

play fullscreen
1 / 44

Antisense Approach to Target MDR Tuberculosis - PowerPoint PPT Presentation


  • 105 Views
  • Uploaded on

Antisense Approach to Target MDR Tuberculosis. Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi. Introduction & Objectives Background & Significance Overview of MDR TB Impact and Importance Research Design & Methods Previous studies and findings Mechanism to new approach

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Antisense Approach to Target MDR Tuberculosis' - cassie


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
antisense approach to target mdr tuberculosis

Antisense Approach to Target MDR Tuberculosis

Diane Meas

Michael Nguyen

Michael DeSalvio

Michael Boateng-Antwi

agenda

Introduction & Objectives

  • Background & Significance
    • Overview of MDR TB
    • Impact and Importance
  • Research Design & Methods
    • Previous studies and findings
    • Mechanism to new approach
    • Assay Methods
  • Conclusion

Agenda

introduction

TB – Overview

    • Infectious airborne disease caused by Mycobacterium tuberculosis
    • 2009 incident cases 9.4 million
    • 2009 prevalent cases 14 million
    • Mortality: - 1.8 million
    • Funding : $5 billion
    • Estimated Funding for 2011: $6 billion
    • (source: WHO Global TB Report, 2010)

Introduction

interventions

Anti-TB drugs (www.cdc.gov/tb/publications)

    • Frontline: rifampicin, isoniazid, pyrizinamide, and ethambutol
    • Second line: fluoroquinolones, amikacin, kanamycin, or capreomycin
  • Drug Resistance: 250,000 reported (WHO-TB, 2010)
  • Options for Disease control
    • Development of new line of drugs
    • Reversal of drug resistance
  • Antisense Technology

Interventions

objectives

Design an antisense molecule against a gene in mycobacterium.

  • Develop in vitro assay to test the maximum effect of antisense molecule in mycobacterium

Objectives

background significance

Background & Significance

Antibiotics Mechanism of Action (Michel J. Cloutier2, 1995)

Protein Synthesis

Folate Metabolism

Cell wall Synthesis

Cell Membrane

DNA gyrase

DNA-directed RNA-polymerase

background and significance

Mechanisms of Antibiotic Resistance (Morris et al, 1995)

    • Antibiotic modification by bacterial enzymes
    • Preventing the antibiotic from entering the cell or pumping it out (efflux) faster than it can flow in.
    • Production of an alternative target (usually an enzyme) that is resistant to inhibition
    • Alterations in the primary site of action

Background and Significance

background significance9

Penicillin 2. Cephalosporin

  • Red Structure - β-lactam core ring

Background & Significance

β-lactam antibiotics

broad class of drugs with β-lactam ring as nucleus of molecular structure

Inhibit 4 – 8 enzymes (PBP) engaged in cell wall biosynthesis.

β-lactamases cleave β-lactam ring in antibiotic to make drug ineffective

antisense overview

Made up of RNA

  • Generally short strands
  • Complementary to the mRNA strand
  • Intercept and bind mRNA
    • Prevent Translation
    • No Gene Expression!

Antisense Overview

http://cdn.venturebeat.com/wp-content/uploads/2007/11/800px-antisense_dna_oligonucleotide.jpg

antisense treatments

Used to treat various treatments

    • Cytomegalovirus retinitis
    • Hemorrhagic fever viruses
    • Cancer (TGF-beta2)
    • HIV/AIDS
    • High cholesterol (mipobersen, 2010 ph-IV)

Antisense Treatments

proof of principle

Harth et.al:

    • Used phophorothioate-modified oligodeoxyribonucleotides (PS-ODNs)
    • targeted mycolyl transferases to inhibit essential genes

Proof of Principle

proof of principle13

Harth et.al:

    • Saw a reduction in antigen 85A, 85B and 85C
      • (Refered to as 32A, 30 and 32B)
      • Reduction in expression also reduced bacterial growth
      • Demonstrated successfully that antisense strategy is effective
      • Successfully inhibited growth in M. tuberculosis (human)

Proof of Principle

proof of principle14

Dasgupta et al:

    • Knocked out Penicillin Binding Proteins (PBPA)
      • serine acyl transferases involved in cell wall expansion, cell shape maintenance, septum formation and cell division
    • Relied on mutation of PknB precursor proteins responsible for the phosphorylation of the PBPA
    • Inactivation of PnkB results in no phosphorylation of PBPA  Cell death

Proof of Principle

current solutions

Clavulanic Acid

    • GlaxoSmithKline
    • B-lactamase inhibitor
    • Competitive inhibition
      • Binds to active site, causing irreversible covalence
    • Derived from S. clavuligerus
    • Concurrent Administration with Amoxicillin

Current Solutions

current solutions16

Adverse Effects!

    • Increased Cholestatic Jaundice
    • Acute hepatitis
    • Some microbial resistance
    • Allergy

Current Solutions

midpoint recap

Rifampicin resistance in M. tuberculosis

  • PS-ODNs and gene knockouts were shown as effective means of bypassing drug resistance and restore drug sensitivity to microorganism
  • Current approach can develop serious side effects
  • New Antisense approach will have reduced side effects

Midpoint Recap

overview of pknb proposal

PknB prevents the synthesis of PBPA (penicillin binding protein)

  • PknB phosphorlyates b-lactamase for insertion into the cell membrane
    • No PknB means no lactamase expression
  • Antisense mRNA peptide nucleotides (PNAs) bind to the active site of PknB and prevent PknB synthesis by steric hindrance
  • Downstream effects would be the loss of B-lactamase synthesis leading drug sensitivity
  • No b-lactamase may also weaken cell wall structure leading to cell death

Overview of PknB Proposal

research design methods

Target other essential genes:

    • Target a Serine/ Threonine protein kinase (STPK)
    • PknB
    • Indirectly affects synthesis of B-Lactamases
    • Effectively causes bacteria to be sensitive to B-Lactam Class antibiotics

Research Design & Methods

nucleotide sequence

ATGACCACCCCTTCCCACCTGTCCGACCGCTACGAACTTGGCGAAATCCTTGGATTTGGGGGCATGTCCGAGGTCCACCTGGCCCGCGACCTCCGGTTGCACCGCGACGTTGCGGTCAAGGTGCTGCGCGCTGATCTAGCCCGCGATCCCAGTTTTTACCTTCGCTTCCGGCGTGAGGCGCAAAACGCCGCGGCATTGAACCACCCTGCAATCGTCGCGGTCTACGACACCGGTGAAGCCGAAACGCCCGCCGGGCCATTGCCCTACATCGTCATGGAATACGTCGACGGCGTTACCCTGCGCGACATTGTCCACACCGAAGGGCCGATGACGCCCAAACGCGCCATCGAGGTCATCGCCGACGCCTGCCAAGCGCTGAACTTCAGTCATCAGAACGGAATCATCCACCGTGACGTCAAGCCGGCGAACATCATGATCAGCGCGACCAATGCAGTAAAGGTGATGGATTTCGGCATCGCCCGCGCCATTGCCGACAGCGGCAACAGCGTGACCCAGACCGCAGCAGTGATCGGCACGGCGCAGTACCTGTCACCCGAACAGGCCCGGGGTGATTCCGTCGACGCCCGATCCGATGTCTATTCCTTGGGCTGTGTTCTTTATGAAGTCCTCACCGGGGAGCCACCTTTCACCGGCGACTCACCCGTCTCGGTTGCCTACCAACATGTGCGCGAAGACCCGATCCCACCTTCGGCGCGGCACGAAGGCCTCTCCGCCGACCTGGACGCCGTCGTTCTCAAGGCGCTGGCCAAAAATCCGGAAAACCGCTATCAGACAGCGGCGGAGATGCGCGCCGACCTGGTCCGCGTGCACAACGGTGAGCCGCCCGAGGCGCCCAAAGTGCTCACCGATGCCGAGCGGACCTCGCTGCTGTCGTCTGCGGCCGGCAACCTTAGCGGTCCGCGCACCGATCCGCTACCACGCCAGGACTTAGACGACACCGACCGTGACCGCAGCATCGGTTCGGTGGGCCGTTGGGTTGCGGTGGTCGCCGTGCTCGCTGTGCTGACCGTCGTGGTAACCATCGCCATCAACACGTTCGGCGGCATCACCCGCGACGTTCAAGTTCCCGACGTTCGGGGTCAATCCTCCGCCGACGCCATCGCCACACTGCAAAACCGGGGCTTCAAAATCCGCACCTTGCAGAAGCCGGACTCGACAATCCCACCGGACCACGTTATCGGCACCGACCCGGCCGCCAACACGTCGGTGAGTGCAGGCGACGAGATCACAGTCAACGTGTCCACCGGACCCGAGCAACGCGAAATACCCGACGTCTCCACGCTGACATACGCCGAAGCGGTCAAGAAACTGACTGCCGCCGGATTCGGCCGCTTCAAGCAAGCGAATTCGCCGTCCACCCCGGAACTGGTGGGCAAGGTCATCGGGACCAACCCGCCAGCCAACCAGACGTCGGCCATCACCAATGTGGTCATCATCATCGTTGGCTCTGGTCCGGCGACCAAAGACATTCCCGATGTCGCGGGCCAGACCGTCGACGTGGCGCAGAAGAACCTCAACGTCTACGGCTTCACCAAATTCAGTCAGGCCTCGGTGGACAGCCCCCGTCCCGCCGGCGAGGTGACCGGCACCAATCCACCCGCAGGCACCACAGTTCCGGTCGATTCAGTCATCGAACTACAGGTGTCCAAGGGCAACCAATTCGTCATGCCCGACCTATCCGGCATGTTCTGGGTCGACGCCGAACCACGATTGCGCGCGCTGGGCTGGACCGGGATGCTCGACAAAGGGGCCGACGTCGACGCCGGTGGCTCCCAACACAACCGGGTCGTCTATCAAAACCCGCCGGCGGGGACCGGCGTCAACCGGGACGGCATCATCACGCTGAGGTTCGGCCAGTAGATGACCACCCCTTCCCACCTGTCCGACCGCTACGAACTTGGCGAAATCCTTGGATTTGGGGGCATGTCCGAGGTCCACCTGGCCCGCGACCTCCGGTTGCACCGCGACGTTGCGGTCAAGGTGCTGCGCGCTGATCTAGCCCGCGATCCCAGTTTTTACCTTCGCTTCCGGCGTGAGGCGCAAAACGCCGCGGCATTGAACCACCCTGCAATCGTCGCGGTCTACGACACCGGTGAAGCCGAAACGCCCGCCGGGCCATTGCCCTACATCGTCATGGAATACGTCGACGGCGTTACCCTGCGCGACATTGTCCACACCGAAGGGCCGATGACGCCCAAACGCGCCATCGAGGTCATCGCCGACGCCTGCCAAGCGCTGAACTTCAGTCATCAGAACGGAATCATCCACCGTGACGTCAAGCCGGCGAACATCATGATCAGCGCGACCAATGCAGTAAAGGTGATGGATTTCGGCATCGCCCGCGCCATTGCCGACAGCGGCAACAGCGTGACCCAGACCGCAGCAGTGATCGGCACGGCGCAGTACCTGTCACCCGAACAGGCCCGGGGTGATTCCGTCGACGCCCGATCCGATGTCTATTCCTTGGGCTGTGTTCTTTATGAAGTCCTCACCGGGGAGCCACCTTTCACCGGCGACTCACCCGTCTCGGTTGCCTACCAACATGTGCGCGAAGACCCGATCCCACCTTCGGCGCGGCACGAAGGCCTCTCCGCCGACCTGGACGCCGTCGTTCTCAAGGCGCTGGCCAAAAATCCGGAAAACCGCTATCAGACAGCGGCGGAGATGCGCGCCGACCTGGTCCGCGTGCACAACGGTGAGCCGCCCGAGGCGCCCAAAGTGCTCACCGATGCCGAGCGGACCTCGCTGCTGTCGTCTGCGGCCGGCAACCTTAGCGGTCCGCGCACCGATCCGCTACCACGCCAGGACTTAGACGACACCGACCGTGACCGCAGCATCGGTTCGGTGGGCCGTTGGGTTGCGGTGGTCGCCGTGCTCGCTGTGCTGACCGTCGTGGTAACCATCGCCATCAACACGTTCGGCGGCATCACCCGCGACGTTCAAGTTCCCGACGTTCGGGGTCAATCCTCCGCCGACGCCATCGCCACACTGCAAAACCGGGGCTTCAAAATCCGCACCTTGCAGAAGCCGGACTCGACAATCCCACCGGACCACGTTATCGGCACCGACCCGGCCGCCAACACGTCGGTGAGTGCAGGCGACGAGATCACAGTCAACGTGTCCACCGGACCCGAGCAACGCGAAATACCCGACGTCTCCACGCTGACATACGCCGAAGCGGTCAAGAAACTGACTGCCGCCGGATTCGGCCGCTTCAAGCAAGCGAATTCGCCGTCCACCCCGGAACTGGTGGGCAAGGTCATCGGGACCAACCCGCCAGCCAACCAGACGTCGGCCATCACCAATGTGGTCATCATCATCGTTGGCTCTGGTCCGGCGACCAAAGACATTCCCGATGTCGCGGGCCAGACCGTCGACGTGGCGCAGAAGAACCTCAACGTCTACGGCTTCACCAAATTCAGTCAGGCCTCGGTGGACAGCCCCCGTCCCGCCGGCGAGGTGACCGGCACCAATCCACCCGCAGGCACCACAGTTCCGGTCGATTCAGTCATCGAACTACAGGTGTCCAAGGGCAACCAATTCGTCATGCCCGACCTATCCGGCATGTTCTGGGTCGACGCCGAACCACGATTGCGCGCGCTGGGCTGGACCGGGATGCTCGACAAAGGGGCCGACGTCGACGCCGGTGGCTCCCAACACAACCGGGTCGTCTATCAAAACCCGCCGGCGGGGACCGGCGTCAACCGGGACGGCATCATCACGCTGAGGTTCGGCCAGTAG

Nucleotide Sequence

amino acid sequence

MTTPSHLSDRYELGEILGFGGMSEVHLARDLRLHRDVAVKVLRADLARDPSFYLRFRREAQNAAALNHPAIVAVYDTGEAETPAGPLPYIVMEYVDGVTLRDIVHTEGPMTPKRAIEVIADACQALNFSHQNGIIHRDVKPANIMISATNAVKVMDFGIARAIADSGNSVTQTAAVIGTAQYLSPEQARGDSVDARSDVYSLGCVLYEVLTGEPPFTGDSPVSVAYQHVREDPIPPSARHEGLSADLDAVVLKALAKNPENRYQTAAEMRADLVRVHNGEPPEAPKVLTDAERTSLLSSAAGNLSGPRTDPLPRQDLDDTDRDRSIGSVGRWVAVVAVLAVLTVVVTIAINTFGGITRDVQVPDVRGQSSADAIATLQNRGFKIRTLQKPDSTIPPDHVIGTDPAANTSVSAGDEITVNVSTGPEQREIPDVSTLTYAEAVKKLTAAGFGRFKQANSPSTPELVGKVIGTNPPANQTSAITNVVIIIVGSGPATKDIPDVAGQTVDVAQKNLNVYGFTKFSQASVDSPRPAGEVTGTNPPAGTTVPVDSVIELQVSKGNQFVMPDLSGMFWVDAEPRLRALGWTGMLDKGADVDAGGSQHNRVVYQNPPAGTGVNRDGIITLRFGQMTTPSHLSDRYELGEILGFGGMSEVHLARDLRLHRDVAVKVLRADLARDPSFYLRFRREAQNAAALNHPAIVAVYDTGEAETPAGPLPYIVMEYVDGVTLRDIVHTEGPMTPKRAIEVIADACQALNFSHQNGIIHRDVKPANIMISATNAVKVMDFGIARAIADSGNSVTQTAAVIGTAQYLSPEQARGDSVDARSDVYSLGCVLYEVLTGEPPFTGDSPVSVAYQHVREDPIPPSARHEGLSADLDAVVLKALAKNPENRYQTAAEMRADLVRVHNGEPPEAPKVLTDAERTSLLSSAAGNLSGPRTDPLPRQDLDDTDRDRSIGSVGRWVAVVAVLAVLTVVVTIAINTFGGITRDVQVPDVRGQSSADAIATLQNRGFKIRTLQKPDSTIPPDHVIGTDPAANTSVSAGDEITVNVSTGPEQREIPDVSTLTYAEAVKKLTAAGFGRFKQANSPSTPELVGKVIGTNPPANQTSAITNVVIIIVGSGPATKDIPDVAGQTVDVAQKNLNVYGFTKFSQASVDSPRPAGEVTGTNPPAGTTVPVDSVIELQVSKGNQFVMPDLSGMFWVDAEPRLRALGWTGMLDKGADVDAGGSQHNRVVYQNPPAGTGVNRDGIITLRFGQ

Amino Acid Sequence

rna active site w domains

UACGAACUUGGCGAA AUCCUUGGAUUUGGG GGCAUGUCCGAGGUC CACCUGGCCCGCGAC CUCCGGUUGCACCGC GACGUUGCGGUCAAG GUGCUGCGCGCUGAU CUAGCCCGCGAUCCC AGUUUUUACCUUCGC UUCCGGCGUGAGGCG CAAAACGCCGCGGCA UUGAACCACCCUGCA AUCGUCGCGGUCUAC GACACCGGUGAAGCC GAAACGCCCGCCGGG CCAUUGCCCUACAUC GUCAUGGAAUACGUC GACGGCGUUACCCUG CGCGACAUUGUCCAC ACCGAAGGGCCGAUG ACGCCCAAACGCGCC AUCGAGGUCAUCGCC GACGCCUGCCAAGCG CUGAACUUCAGUCAU CAGAACGGAAUCAUC CACCGUGACGUCAAG CCGGCGAACAUCAUG AUCAGCGCGACCAAU GCAGUAAAGGUGAUG GAUUUCGGCAUCGCC CGCGCCAUUGCCGAC AGCGGCAACAGCGUG ACCCAGACCGCAGCA GUGAUCGGCACGGCG CAGUACCUGUCACCC GAACAGGCCCGGGGU GAUUCCGUCGACGCC CGAUCCGAUGUCUAU UCCUUGGGCUGUGUU CUUUAUGAAGUCCUC ACCGGGGAGCCACCU UUCACCGGCGACUCA CCCGUCUCGGUUGCC UACCAACAUGUGCGC GAAGACCCGAUCCCA CCUUCGGCGCGGCAC GAAGGCCUCUCCGCC GACCUGGACGCCGUC GUUCUCAAGGCGCUG GCCAAAAAUCCGGAA AACCGCUAUCAGACA GCGGCGGAGAUGCGC GCCGACCUGGUC

RNA Active Site w/ Domains

efficiency of pna

PNA stands for peptide nucleic acids

  • Antisense PNAs are larger than most drugs
    • PNA size/length is an important parameter for efficiency
    • PNAs targeted to the start codon region of the chromosomal β-galactosidase gene (lacZ) were synthesized over 7- to 15-mer size range
  • E. coli outer cell wall is a major barrier to PNAs, so need to find a more efficient technique

Efficiency of PNA

efficiency of the kffkffkffk cap

Also expressed as (KFF)3K

  • This is a synthetic peptide and it is a cell wall-permeating peptide
  • When this cap is conjugated to PNA oligomers, it could enhance the uptake and efficiency of antisense PNAs

Efficiency of the KFFKFFKFFK cap

peptide nucleic acids

Outperforms Oligonucleotides

  • 7-15 mer lengths
  • Capped with KFFKFFKFFK – synthetic molecule shown to increase PNA uptake into cell
  • PNA immune to exonuclease activity

Peptide Nucleic Acids

mrna and its antisense pna

5’-GACGUUGCGUCAAGGUGUCUGCGCGCUGAU-3’

3’-CUGCAACGCAGUUCGACAGACGCGCGACUA-CAP-5’

5’-CACCGUGACGUCAAGCCGGCGAACAUCAUG-3’

3’-GUGGCACUGCAGUUCGGCCGCUUGUAGUAC-CAP-5’

5’-GCAGUAAAGGUGAUGGAUUUCGGCAUCGCC-3’

3’-CGUCAUUUCCACUACCUAAAGCCGUAGCGG-CAP-5’

5’-AGCGGCAACAGCGUGACCCAGACCGCAGCA-3'

3’-UCGCCGUUGUCGCUCUGGGUCUGGCGUCGU-CAP-5’

5’-AGAUAGCGCAAUGACCACCCCUUCCCACCU-3’

3’-UCUAUCGCGUUACUGGUGGGGUUGGGUGGA-CAP-5’

mRNA and its Antisense PNA

whole cell assay

 BioSafety Level 1

  • Mycobacteria smegmatis
  • Middlebrook 7H9 Broth Media
  • Middlebrook 7H10 Agar Media
  • β-Lactam Antibiotic Library

Whole Cell Assay

assay method
Assay Method
  • Grow Mycobacteria for 7 days @ 35oC in 7H9
  • Take OD reading (A600)
  • Transfer culture to 96-well plates
  • Screen against various PNAs (going across) 
  • Vary concentrations of PNAs (doing down)
  • Screen multiple B-lactam class antibiotics
  • HTS Method 
  • 2-Day OD readings (up to 8 weeks)
    • Can change depending on growth rate
assay plate
Assay Plate
  • One B-lactam antibiotic treated across entire plate
  • Every well contains M. smegmatis
antibiotics beta lactams
Antibiotics: Beta-Lactams
  • Glycopeptides
    • Vancomycin, Teicoplanin
  • Penicillins
    • Amoxicillin, Ampicillin, Azlocillin, Mecillinam
    • Benzylpenicillin, Clometocillin
    • *Cloxacillin, *Oxacillin, *Nafcillin(*B-lactamase resistant)
  • Cephalosporins
    • Cefazolin, Cefapirin, Ceftezole
    • Cefamandole, Cefprozil, Cefminox
    • Cefixime, Ceftrixone, Cefpimizole
    • Ceftiofur
  • Monobactams
    • Aztreonam, Tigemonam
expected results
Expected Results
  • No effect on Proliferation in Buffer wells
  • Reduction in Mycobacteria growth over time on PNA wells
  • Higher concentration PNA results in lower OD
  • Clavulanic Acid shows greatest change in growth
future studies
Future Studies
  • Select Promising PNAs for additional screening
  • Screen Against other microorganisms
  • Design PNAs for other essential genes or pathways
contingency assays
Contingency Assays

In the event Mycobacteria does not grow in 96-well plate or detection is poor:

Large Scale Assay

  • Assay repeated using tubes of 7H9 Media (1mL)
  • Smaller β-Lactam library
  • Measure OD via spectroscopy

Zone of Inhibition Assay

  • Use of 7H10 Agar media
  • Impregnate with β-Lactam
  • Spots of various concentration PNAs
  • Measure inhibition zones
some issues with assay
Some Issues with Assay
  • PNAs not very well studied
    • Mode of transport and toxicity still unclear
  • Not much information with in vivo assays
  • Assumes Mycobacteria can be sensitized to B-Lactam
  • Assumes β-Lactam will remain active
    • Not cleaved or lysed by Lactamases
summary
Summary
  • Tuberculosis is a worldwide epidemic
  • Wide proliferation have created Multi-Drug Resistant Strains
  • First Line defense, Rifampicin, Ineffective
  • New Approach: Return sensitivity to B-Lactam
  • Inhibit Expression of PknB at mRNA level
    • Prevents Phosphorylation of Penicllin Binding Proteins
    • Prevents expression of PBP on Cell surface (B-Lactamases)
  • Synthesize Peptide Nucleic Acids (PNAs) for specificity
  • HTS Assays
    • Against B-Lactam Library