carlos-goff
Uploaded by
43 SLIDES
555 VIEWS
430LIKES

2007-2008

DESCRIPTION

From Gene to Protein. How Genes Work. AP Biology. 2007-2008. What do genes code for?. How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA. DNA. proteins. cells. bodies. AP Biology. protein. RNA. DNA. trait.

1 / 43

Download Presentation

2007-2008

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. From Gene to Protein How Genes Work AP Biology 2007-2008

  2. What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA DNA proteins cells bodies AP Biology

  3. protein RNA DNA trait DNA gets all the glory, but proteins do all the work! The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? AP Biology

  4. metabolic pathway disease disease disease disease Am I just the sum of my proteins? E D A B C Metabolism taught us about genes • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism     enzyme 1 enzyme 2 enzyme 3 enzyme 4 AP Biology

  5. one gene : one enzyme hypothesis 1941 | 1958 Beadle & Tatum George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" AP Biology

  6. amino acidsupplements create mutations positive control mutation identified negative control experimentals X rays or ultraviolet light Wild-type Neurospora asexual spores Minimal medium Growth on complete medium spores Select one of the spores Grow on complete medium Test on minimal medium to confirm presence of mutation Minimal media supplemented only with… Choline Pyridoxine Riboflavin Minimal control Nucleic acid Arginine Niacin Inositol Folic acid p-Amino benzoic acid Thiamine Beadle & Tatum AP Biology

  7. DNA protein mRNA trait aa aa aa aa aa aa aa aa aa aa aa From gene to protein nucleus cytoplasm AP Biology

  8. Transcription • fromDNA nucleic acid languagetoRNA nucleic acid language AP Biology 2007-2008

  9. RNA DNA RNA • ribose sugar • N-bases • ____________________ • ____________________ • ____________________ • ____________________ • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription AP Biology

  10. build RNA 5′→3′ Transcription • Making mRNA • transcribed DNA strand = ___________________ • untranscribed DNA strand = ________________ • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • __________________________ coding strand 3′ A G C A T C G T 5′ A G A A A C G T T T T C A T C G A C T DNA 3′ C T G A A 5′ T G G C A U C G U T C unwinding 3′ G T A G C A rewinding mRNA template strand RNA polymerase 5′ AP Biology

  11. RNA polymerases • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • ______________________ • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes AP Biology

  12. Which gene is read? • ________________________ • binding site before beginning of gene • __________________________________ • binding site for RNA polymerase & transcription factors • ________________________ • binding site far upstream of gene • turns transcription on HIGH AP Biology

  13. Transcription Factors • Initiation complex • ___________________________________________ • suite of proteins which bind to DNA • hormones? • turn on or off transcription • trigger the binding of RNA polymerase to DNA AP Biology

  14. 3' 5' RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T AP Biology

  15. eukaryotic DNA intron = noncoding (inbetween) sequence intronscome out! exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • ___________ = the real gene • expressed / coding DNA • ___________ = the junk • inbetween sequence AP Biology

  16. eukaryotic DNA primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • ______________________________ • ______________________________ • edit out introns • ______________________________ ~10,000 bases ~1,000 bases AP Biology

  17. 1977 | 1993 Discovery of exons/introns Richard Roberts Philip Sharp adenovirus CSHL MIT common cold beta-thalassemia AP Biology

  18. Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| AP Biology

  19. No, not smurfs! “snurps” Whoa! I think we just brokea biological “rule”! snRNPs snRNA spliceosome intron exon exon 5' 3' 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes • _________________ • ________________ • proteins • _________________ • several snRNPs • recognize splice site sequence • cut & paste gene AP Biology

  20. Starting to gethard to define a gene! Alternative splicing • _______________________________________ • when is an intron not an intron… • different segments treated as exons AP Biology

  21. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • ________________________________ • ________________________________ AP Biology

  22. protein mRNA DNA trait aa aa aa aa aa aa aa aa aa aa aa ribosome From gene to protein nucleus cytoplasm transcription translation AP Biology

  23. Translation • fromnucleic acid languagetoamino acid language AP Biology 2007-2008

  24. ? TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC MetArgValAsnAlaCysAla DNA mRNA protein 20 4 4 How does mRNA code for proteins? • How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? ATCG AUCG AP Biology

  25. ? AUGCGUGUAAAUGCAUGCGCC codon MetArgValAsnAlaCysAla TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC mRNA DNA mRNA protein mRNA codes for proteins in triplets AP Biology

  26. WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT 1960 | 1968 Cracking the code Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine AP Biology

  27. 1960 | 1968 Marshall Nirenberg Har Khorana AP Biology

  28. _______________ • AUG • methionine • _______________ • UGA, UAA, UAG The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” AP Biology

  29. aminoacid CAU GCA UAC Val Arg Met tRNA DNA mRNA codon anti-codon How are the codons matched to amino acids? 3′ 5′ TACGCACATTTACGTACGCGG 5′ 3′ AUGCGUGUAAAUGCAUGCGCC 3′ 5′ AP Biology

  30. protein mRNA DNA trait aa aa aa aa aa aa aa aa aa aa aa ribosome From gene to protein nucleus cytoplasm transcription translation AP Biology

  31. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3′ end AP Biology

  32. Loading tRNA • __________________________________________ • enzyme which bonds amino acid to tRNA • bond requires energy • ATP → AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp AP Biology tRNATrp binds to UGG condon of mRNA

  33. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • _____________________________ • _________________ • _____________ • _____________ E P A AP Biology

  34. A P E Ribosomes • ____________ (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • ____________(peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • ____________(exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' AP Biology

  35. 1 2 3 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A AP Biology

  36. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • ______________________ • _____________________ start of a secretory pathway AP Biology

  37. Can you tell the story? AP Biology

  38. 20-30b enhancer introns exons 5' 3' 5' 3' The Transcriptional unit 1000+b transcriptional unit 3' 5' TAC ACT DNA AP Biology

  39. Protein Synthesis in Prokaryotes Psssst…no nucleus! Bacterial chromosome Transcription mRNA Cell membrane Cell wall AP Biology 2007-2008

  40. intron = noncoding (inbetween) sequence intronscome out! exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes • Prokaryotes • _________________ • _________________ _________________ • _________________ • _________________ • Eukaryotes • _________________ • _________________ _________________ • _________________ _________________ • _________________ eukaryotic DNA AP Biology

  41. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed AP Biology

  42. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • RNA processing AP Biology

  43. Any Questions?? What color would a smurf turnif he held his breath? AP Biology 2007-2008

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer