1 / 21

Molecular Evolution

Molecular Evolution. Lecture 3. Origins of variation: mutation. Different molecular regions, different rates. DNA distant from genes evolves very quickly (at about one substitution per 10 8 years), Flanking regions upstream and downstream from a gene evolve less quickly than that,

cameron-white
Download Presentation

Molecular Evolution

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular Evolution Lecture 3. Origins of variation: mutation

  2. Different molecular regions, different rates • DNA distant from genes evolves very quickly (at about one substitution per 108 years), • Flanking regions upstream and downstream from a gene evolve less quickly than that, • Introns evolve less quickly than those, though not much less, • Third positions of codons evolve less quickly than introns, • First and second positions of codons evolve less quickly than that,

  3. Different molecular regions, different rates Within a protein: – active sites evolve very slowly, – sites that bind heme, or interact with other proteins evolve a bit faster but also very slowly, – interior sites evolve less quickly than exterior sites, – substitutions that involve less radical changes of the amino acid (i.e. that change to a rather similar amino acid) happen more readily. Of base changes, transitions (A -> G or C -> T) happen several times more readily than transversions (all other changes). Between protein-coding loci, some (fibrinopeptide, for example) evolve rapidly, some less so (hemoglobins, cytochromes), and some (histones, for example) change very slowly.

  4. Rates and causes of molecular evolution • Different parts of the genome are useful for answering different problems. Fast evolving sequences are useful for recent events, but become saturated and unrecognizable when comparing more distant relatives. Slow evolving sequences are useful around the base of the tree, but don’t have any variability at all among close relatives.

  5. Effects of replication timing... • Genes near replication origins are duplicated early and hence experience greater copy number than those replicated last • Copy # correlates with expression • Expression inversely correlates with evolutionary rate • So: genes replicated first evolve more slowly

  6. Kinds of mutations: • 1. Point mutations (Base substitutions) • 2. Reading frame shifts • 3. Large scale insertions (Bacteriophage; Transposons) • 4. Large scale deletions • 5. Thymine (pyrimidine) dimers • 6. Gross damage - X-rays, gamma rays, etc. • (Some mutations are caused by improper [template-free] • DNA repair - i.e. SOS repair)

  7. 1. Point Mutations (Base substitutions)

  8. Substitutions (base-pair substitutions) Two Types 1. Transitions - purine for a purine G  A - pyrimidine for a pyrimidine C  T 2. Transversions - purine for pyrimidine G  C G  T - pyrimidine for purine

  9. SILENT= bp change does not affect the amino acid that is encoded. e.g. UGC -> UGU is silent because both are codons for cysteine. * AUGCCCGGGUACUGCCGAGUG MetProGlyTyrCysArgVal AUGCCCGGGUACUGUCGAGUG MetProGlyTyrCysArgVal C T transition in DNA sequence resulted in C  U change in mRNA

  10. AUGCCCGGGUACGAACGAGUG MetProGlyTyrGluArgVal AUGCCCGGGUACGAACGAGUG AUGCCCGGGUACGAUCGAGUG MetProGlyTyrGluArgVal MetProGlyTyrAspArgVal AUGCCCGGGUACAAACGAGUG MetProGlyTyrLysArgVal MISSENSE (replacement)= bp change alters the amino acid that is encoded. The severity of the mutation depends on the nature of the change. e.g. the changeGAA -> GAU will change glutamic acidtoaspartic acid. * * However, the change GAA -> AAA would be significant since it replaces glutamic acid with lysine which is very different.

  11. AUGCCCGGGUACGAACGAGUG AUGCCCGGGUAGGAACGAGUG MetProGlyTyrGluArgVal MetProGlySTOP NONSENSE= bp change results in the creation of a stop codon. Proteins will be truncated as a result of this type of mutation. e.g. the changeUAC -> UAG. * Truncated proteins usually have no function and can be detrimental to the cell

  12. Nonsense Mutations Wildtype gene Start Stop mRNA Nonsense Mutation Start Stop mRNA Inactive peptide fragment

  13. 2. Reading frame shifts:

  14. gene A 5’ gene B gene C 5’ 3’ 3’ Transcription 5’ Translation Transcription and Translation are coupled in bacteria, so nonsense substitutions have *polar* effects (polarity) gene A 5’ gene B gene C 5’ 3’ 3’ Transcription Stop codon 5’ Translation

  15. Slipped strand mispairing http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=hmg.figgrp.1097

  16. Holliday junction / crossing over • http://engels.genetics.wisc.edu/Holliday/holliday3D.html

  17. 3. Transposition; transposon mutagenesis; “jumping genes”

  18. Transposase gene Antibiotic resistance gene(s) Mutations (insertions) caused by IS elements and Transposons:

  19. Rates of Mutation A. Spontaneous mutation • result from errors in replication • frequency of 10-7 to 10-10 per bp per generation B. Induced mutation • result from application of chemical and physical agents (mutagens) • increase the frequency of a mutation

  20. Is the mutation rate optimal or minimal?

  21. A comparison of mutation rates

More Related