John 1:12
Download
1 / 75

John 1:12 - PowerPoint PPT Presentation


  • 95 Views
  • Uploaded on

John 1:12 12 But as many as received him, to them gave he power to become the sons of God, even to them that believe on his name:. Endosymbiosis and the Origin of Eukaryotes: Are mitochondria really just bacterial symbionts?. Timothy G. Standish, Ph. D. Outline.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' John 1:12 ' - calista-riley


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
John 1 12

John 1:12

12 But as many as received him, to them gave he power to become the sons of God, even to them that believe on his name:


Endosymbiosis and the origin of eukaryotes are mitochondria really just bacterial symbionts

Endosymbiosis and the Origin of Eukaryotes:Are mitochondria really just bacterial symbionts?

Timothy G. Standish, Ph. D.


Outline
Outline

  • Mitochondria - A very brief overview

  • Endosymbiosis - Theory and evidence

  • Archaezoa - Eukaryotes lacking mitochondria

  • Gene expression - Mitochondrial proteins coded in the nucleus

  • Mitochondrial genetic codes

  • Gene transport - Mitochondria to nucleus

  • Conclusions


Mitochondria
Mitochondria

  • Mitochondria are organelles found in most eukaryotic organisms.

  • The site of Krebs cycle and electron transport energy producing processes during aerobic respiration

  • Are inherited only from the mother during sexual reproduction in mammals and probably all other vertebrates.

  • Because of their mode of inheritance genetic material found in mitochondria appears to be useful in determining the maternal lineage of organisms.


Mitochondria1
Mitochondria

Outer membrane

Inner membrane

mtDNA

Matrix

Inter membrane space


Extranuclear dna
Extranuclear DNA

  • Mitochondria and chloroplasts have their own DNA

  • This extranuclear DNA exhibits non-Mendelian inheritance

  • Recombination is known between some mt and ctDNAs

  • Extranuclear DNA may also be called cytoplasmic DNA

  • Generally mtDNA and ctDNA is circular and contains genes for multimeric proteins, some portion of which are also coded for in the nucleus

  • Extranuclear DNA has a rate of mutation that is independent of nuclear DNA

  • Generally, but not always, all the RNAs needed for transcription and translation are found in mtDNA and ctDNA, but only some of the protein genes


Mtdna
mtDNA

  • Mitochondrial DNA is generally small in animal cells, about 16.5 kb

  • In other organisms sizes can be more than an order of magnitude larger

  • Plant mtDNA is highly variable in size and content with the large Arabidopsis mtDNA being 200 kb.

  • The largest known number of mtDNA protein genes is 97 in the protozoan Riclinomonas mtDNA of 69 kb.

  • “Most of the genetic information for mitochondrial biogenesis and function resides in the nuclear genome, with import into the organelle of nuclear DNA-specified proteins and in some cases small RNAs.” (Gray et al.,1999)



Origin of eukaryotes
Origin of Eukaryotes

Two popular theories presupposing naturalism seek to explain the origin of membrane bound organelles:

1Endosymbiosis to explain the origin of mitochondria and chloroplasts (popularized by Lynn Margulis in 1981)

2Invagination of the plasma membrane to form the endomembrane system


Origin of eukaryotes1
Origin of Eukaryotes

Mitochondria

Two popular theories presupposing naturalism seek to explain the origin of membrane bound organelles:

1Endosymbiosis to explain the origin of mitochondria and chloroplasts (popularized by Lynn Margulis in 1981)

2Invagination of the plasma membrane to form the endomembrane system


Origin of eukaryotes2
Origin of Eukaryotes

Endoplasmic

Reticulum

Mitochondria

Nucleus

Golgi

Body

Chloroplast

Two popular theories presupposing naturalism seek to explain the origin of membrane bound organelles:

1Endosymbiosis to explain the origin of mitochondria and chloroplasts (popularized by Lynn Margulis in 1981)

2Invagination of the plasma membrane to form the endomembrane system


Origin of eukaryotes3
Origin of Eukaryotes

Endoplasmic Reticulum

Mitochondria

Nucleus

Golgi Body

Chloroplast

Two popular theories presupposing naturalism seek to explain the origin of membrane bound organelles:

1Endosymbiosis to explain the origin of mitochondria and chloroplasts (popularized by Lynn Margulis in 1981)

2Invagination of the plasma membrane to form the endomembrane system


How mitochondria resemble bacteria
How Mitochondria Resemble Bacteria

Most general biology texts list ways in which mitochondria resemble bacteria. Campbell et al. (1999) list the following:

  • Mitochondria resemble bacteria in size and morphology.

  • They are bounded by a double membrane: the outer thought to be derived from the engulfing vesicle and the inner from bacterial plasma membrane.

  • Some enzymes and inner membrane transport systems resemble prokaryotic plasma membrane systems.

  • Mitochondrial division resembles bacterial binary fission

  • They contain a small circular loop of genetic material (DNA). Bacterial DNA is also a circular loop.

  • They produce a small number of proteins using their own ribosomes which look like bacterial ribosomes.

  • Their ribosomeal RNA resembles eubacterial rRNA.


How mitochondria don t resemble bacteria
How Mitochondria Don’tResemble Bacteria

  • Mitochondria are not always the size or morphology of bacteria:

    • In some Trypanosomes (i.e., Trypanosoma brucei) mitochondria undergo spectacular changes in morphology that do not resemble bacteria during different lifecycle stages (Vickermann, 1971)

    • Variation in morphology is common in protistans, “Considerable variation in shape and size of the organelle can occur.” (Lloyd, 1974, p 1)

  • Mitochondrial division and distribution of mitochondria to daughter cells is tightly controlled by even the simplest eukaryotic cells


How mitochondria don t resemble bacteria1
How Mitochondria Don’tResemble Bacteria

  • Circular mtDNA replication via D loops is different from replication of bacterial DNA (Lewin, 1997, p 441).

  • mtDNA is much smaller than bacterial chromosomes.

  • Mitochondrial DNA may be linear, examples include: Plasmodium, C. reinhardtii, Ochromonas, Tetrahymena, Jakoba (Gray et al., 1999).

  • Mitochondrial genes may have introns which eubacterial genes typically lack (these introns are different from nuclear introns so they cannot have come from that source) (Lewin, 1997 p 721, 888).

  • The genetic code in many mitochondria is slightly different from bacteria (Lewin, 1997).



Giardia a missing link
Giardia - A “Missing Link”?

  • The eukaryotic parasite Giardia has been suggested as a “missing link” between eukaryotes and prokaryotes because it lacks mitochondria (Friend, 1966; Adam, 1991) thus serving as an example of membrane invagination but not endosymbiosis

  • Giardia also appears to lack smooth endoplasmic reticulum, peroxisomes and nucleoli (Adam, 1991) so these must have either been lost or never evolved


A poor missing link
A Poor “Missing Link”

  • As a “missing link” Giardia is not a strong argument due to its parasitic life cycle which lacks an independent replicating stage outside of its vertebrate host

    • Transmission is via cysts excreted in feces followed by ingestion

    • As an obligate parasite, to reproduce, Giardia needs other more derived (advanced?) eukaryotes

  • Some other free-living Archaezoan may be a better candidate


Origin of giardia
Origin of Giardia

  • Giardia and other eukaryotes lacking mitochondria and plastids (Metamonada, Microsporidia, and Parabasalia ) have been grouped by some as “Archaezoa” (Cavalier-Smith, 1983; Campbell et al., 1999 p 524-6)

  • This name reflects the belief that these protozoa split from the group which gained mitochondria prior to that event.

  • The discovery of a mitochondrial heat shock protein (HSP60) in Giardia lamblia (Soltys and Gupta, 1994) has called this interpretation into question.

  • Other proteins thought to be unique to mitochondria, HSP70 (Germot et al., 1996), chaperonin 60 (HSP60) (Roger et al., 1996; Horner et al., 1996) and HSP10 (Bui et al., 1996) have shown up in Giardia’s fellow Archaezoans


Origin of archaezoa
Origin of Archaezoa

  • The authors who reported the presence of mitochondrial genes in amitochondrial eukaryotes all reinterpreted prevailing theory in saying that mitochondria must have been present then lost after they had transferred some of their genetic information to the nucleus.

  • The hydrogenosome, a structure involved in carbohydrate metabolism found in some Archaezoans (Muller, 1992), is now thought to represent a mitochondria that has lost its genetic information completely and along with that loss, the ability to do the Krebs cycle (Palmer, 1997).

  • Alternative explanations include transfer of genetic material from other eukaryotes and the denovo production of hydrogenosomes by primitive eukaryotes.


Origin of archaezoa mitochondrial acquisition
Origin of Archaezoa:Mitochondrial Acquisition


Origin of archaezoa gene transfer and loss
Origin of Archaezoa:Gene Transfer and Loss

mtGenes

Lost genetic material


Origin of archaezoa option 1 mitochondrial eukaryote production
Origin of Archaezoa:Option 1 - Mitochondrial Eukaryote Production


Origin of archaezoa option 2 mitochondrial dna loss hydrogenosome production
Origin of Archaezoa:Option 2 - Mitochondrial DNA Loss/Hydrogenosome production

Hydrogenosome


Origin of archaezoa option 2a mitochondria hydrogenosome loss
Origin of Archaezoa:Option 2A - Mitochondria/Hydrogenosome Loss



John 1 12

“All in all then, the host nucleus seems to be a tremendous magnet, both for organellar genes and for endosymbiotic nuclear genes.”

Palmer, 1997


Steps in mitochondrial acquisition the serial endosymbiosis theory
Steps in Mitochondrial Acquisition: tremendous magnet, both for organellar genes and for endosymbiotic nuclear genes.”The Serial Endosymbiosis Theory

Fusion of Rickettsia with either a nucleus containing Archaezoan or an archaebacterium

Rickettsia

Host Cell

Primitive eukaryote

DNA reduction/transfer to nucleus

Ancestral eukaryote

(assuming a nucleus)


Steps in mitochondrial acquisition the hydrogen hypothesis
Steps in Mitochondrial Acquisition: tremendous magnet, both for organellar genes and for endosymbiotic nuclear genes.”The Hydrogen Hypothesis

Fusion of proteobacterium with an archaebacterium

Hydrogen producing proteobacterium

Hydrogen requiring archaebacterium

Ancestral eukaryote

With nucleus containing both archaebacterium and proteobacterium genes

DNA reduction/transfer nucleus production


Phylogeny
Phylogeny tremendous magnet, both for organellar genes and for endosymbiotic nuclear genes.”

Microsporidia, and Parabasalia

Bacteria

Metamonada

Eukaryota

Bacteria

mtDNA

loss

Hydrogenosome/

mitochondria

loss

mtDNA

loss

Gene transfer

Origin of Life

Cell fusion


Timing of gene transfer
Timing of Gene Transfer tremendous magnet, both for organellar genes and for endosymbiotic nuclear genes.”

  • Because gene transfer occurred in eukaryotes lacking mitochondria, and these are the lowest branching eukaryotes known:

  • Gene transfer must have happened very early in the history of eukaryotes.

  • The length of time for at least some gene transfer following acquisition of mitochondria is greatly shortened.

  • No plausible mechanism for movement of genes from the mitochondria to the nucleus exists although intraspecies transfer of genes is sometimes invoked to explain the origin of other individual nuclear genes.


Gene expression
Gene Expression tremendous magnet, both for organellar genes and for endosymbiotic nuclear genes.”


Cytoplasmic production of mitochondrial proteins
Cytoplasmic Production of Mitochondrial Proteins tremendous magnet, both for organellar genes and for endosymbiotic nuclear genes.”

  • Mitochondria produce only a small subset of the proteins used in the Krebs cycle and electron transport. The balance come from the nucleus

  • As mitochondrial genomes vary spectacularly between different groups of organisms, some of which may be fairly closely related, if all came from a common ancestor, different genes coding for mitochondrial proteins must have been passed between the nucleus and mitochondria multiple times


The unlikely movement of genes between mitochondria and the nucleus
The Unlikely Movement of Genes Between Mitochondria and the Nucleus

Movement of genes between the mitochondria and nucleus seems unlikely for at least two reasons:

  • Mitochondria do not always share the same genetic code with the cell they are in

  • Mechanisms for transportation of proteins coded in the nucleus into mitochondria seem to preclude easy movement of genes from mitochondria to the nucleus


Protein production mitochondria and chloroplasts
Protein Production NucleusMitochondria and Chloroplasts

Cytoplasm

AAAAAA

Nucleus

G

Export

Mitochondrion

Chloroplast


Protein production mitochondria and chloroplasts1
Protein Production NucleusMitochondria and Chloroplasts

Cytoplasm

Nucleus

Mitochondrion

Chloroplast


Protein production mitochondria
Protein Production NucleusMitochondria

Outer membrane

Inner membrane

Matrix

Inter membrane space


Protein production mitochondria1
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

ATP

P +ADP

ATP

P +ADP

MLSLRQSIRFFKPATRTLCSSRYLL

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria2
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Peptidease cleaves off the leader

MLSLRQSIRFFKPATRTLCSSRYLL

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria3
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

MLSLRQSIRFFKPATRTLCSSRYLL

Inter membrane space

Matrix


Protein production mitochondria4
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria5
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Hsp60

Hsp60

Inner membrane

Inter membrane space

Chaperones

Matrix


Protein production mitochondria6
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Mature protein

Matrix


Yeast cytochrome c oxidase subunit iv leader
Yeast Cytochrome C Oxidase Subunit IV Leader Nucleus

M

L

S

L

Polar

R

Q

S

First 12 residues are sufficient for transport to the mitochondria

Non-

polar

I

R

F

F

K

P

A

T

R

T

L

Polar

Recognized by peptidase?

C

S

S

R

Y

L

P

  • This leader does not resemble other eukaryotic leader sequences, or other mtProtein leader sequences.

  • Probably forms an a helix

  • This would localize specific classes of amino acids in specific parts of the helix

  • There are about 3.6 amino acids per turn of the helix with a rise of 0.54 nm per turn

Neutral Non-polar

Polar

Basic

Acidic

MLSLRQSIRFFKPATRTLCSSRYLL


Yeast cytochrome c1 leader
Yeast Cytochrome C1 Leader Nucleus

Charged leader sequence signals for transport to mitochondria

First cut

Second cut

Uncharged second leader sequence signals for transport across inner membrane into the intermembrane space

  • Cytochrome c functions in electron transport and is thus associated with the inner membrane on the intermembrane space side

  • Cytochrome c1 holds an iron containing heme group and is part of the B-C1 (III) complex

  • C1 accepts electrons from the Reiske protein and passes them to cytochrome c

MFSNLSKRWAQRTLSKTLKGSKSAAGTATSYFE-KLVTAGVAAAGITASTLLYANSLTAGA--------------

Neutral Non-polar

Polar

Basic

Acidic


Protein production mitochondria7
Protein Production NucleusMitochondria

Outer membrane

Inner membrane

Matrix

Inter membrane space


Protein production mitochondria8
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

ATP

P +ADP

ATP

P +ADP

Peptidease cleaves off the leader

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria9
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria10
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria11
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria12
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria13
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Peptidease cleaves off the second leader

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria14
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria15
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Inter membrane space

Matrix


Protein production mitochondria16
Protein Production NucleusMitochondria

Outer membrane

Leader sequence binding receptor

Inner membrane

Mature protein

Note that chaperones are not involved in folding of proteins in the inter membrane space and that they exist in a low pH environment

Inter membrane space

Matrix


Alternative mechanism
Alternative Mechanism Nucleus

  • There are actually two theories about how the leader operates to localize mtproteins in the inter membrane space:

  • The first, as shown in the previous slides, involves the whole protein moving into and then out of the matrix

  • The alternative theory suggests that once the first leader, which targets to the mitochondria is removed, the second leader prevents the protein from ever entering the matrix so it is transported only into the inter membrane space.


Building a minimally functional nuclear mitochondrial gene
Building a Minimally Functional Nuclear Mitochondrial Gene Nucleus

Nuclear DNA

Control Sequence

Signal Sequence

Mitochondrial Gene

Control Sequence

Signal Sequence

Mitochondrial Gene

Additional hurdles may include:

  • Resolution of problems resulting from differences between mitochondrial and nuclear introns

  • Resolution of problems resulting from differences between mitochondrial and nuclear genetic codes

Given that a fragment of DNA travels from the mitochondria to the nucleus and is inserted into the nuclear DNA


Additional requirements
Additional Requirements Nucleus

In addition to addition of appropriate control and leader sequences to mitochondrial genes, the following would be needed:

  • Recognition and transport mechanisms in the cytoplasm

  • Leader sequence binding receptors

  • Peptidases that recognize leader sequences and remove them


No plausible mechanism exists
No Plausible Mechanism Exists Nucleus

  • If genes were to move from the mitochondria to the nucleus they would have to somehow pick up the leader sequences necessary to signal for transport before they could be functional

  • While leader sequences seem to have meaningful portions on them, according to Lewin (1997, p 251) sequence homology between different sequences is not evident, thus there could be no standard sequence that was tacked on as genes were moved from mitochondria to nucleus

  • Alternatively, if genes for mitochondrial proteins existed in the nucleus prior to loss of genes in the mitochondria, the problem remains, where did the signal sequences come from? And where did the mechanism to move proteins with signal sequences on them come from?



Variation in codon meaning
Variation In Codon Meaning Nucleus

Organism

Codon/s

Common Meaning

Modified Meaning

Tetrahymena thermophila

A ciliate

UAAUAG

Stop

glutamine

Paramecium

A ciliate

UAAUAG

Stop

glutamine

Euplotes octacarinatus

A ciliate

UGA

Stop

cysteine

Mycoplasma capricolum

A bacteria

UGA

Stop

tryptophan

Candida

A yeast

CUG

serine

leucine

Neutral Non-polar, Polar

  • Lack of variation in codon meanings across almost all phyla is taken as an indicator that initial assignment must have occurred early during evolution and all organisms must have descended from just one individual with the current codon assignments

  • Exceptions to the universal code are known in a few single-celled eukaryotes, mitochondria and at least one prokaryote

  • Most exceptions are modifications of the stop codons UAA, UAG and UGA


Variation in mitochondrial codon assignment
Variation in Mitochondrial Codon Assignment Nucleus

Cytoplasm/

Nucleus

Platyhelmiths

Echinoderms

Vertebrates

Nematodes

Yeast/

Molds

Molluscs

Insects

Plants

AUA=Met

CUN=Thr

AAA=Asn

AUA=Ile

AAA=Asn

UGA/G=Stop

AUA=Met

AGA/G=Ser

UGA=Trp

Universal

Code

  • NOTE - This would mean AUA changed from Ile to Met, then changed back to Ile in the Echinoderms

  • AAA must have changed from Lys to Asn twice

  • UGA must have changed to Trp then back to stop

  • Differences in mtDNA lower the number of tRNAs needed


Problems resulting from differences in genetic codes
Problems Resulting From Differences in Genetic Codes Nucleus

  • Changing the genetic code, even of the most simple genome is very difficult.

  • Because differences exist in the mitochondrial genomes of groups following changes in the mitochondrial genetic code, mitochondrial genes coding differently must have been transported to the nucleus.

  • These mitochondrial genes must have been edited to remove any problems caused by differences in the respective genetic codes.


Behe goes beyond moustraps
Behe Goes Beyond Moustraps Nucleus

  • In an essay entitled “Intelligent Design theory as a Tool for Analyzing Biochemical Systems,” Michael Behe encourages researchers to go beyond “simple” biochemical systems and to apply Intelligent Design theory to more complex sub-cellular systems. He specifically poses the question:

  • “Given that some biochemical systems were designed by an intelligent agent, and given the tools by which we came to that conclusion, how do we analyze other biochemical systems that may be more complicated and less discrete than the ones we have so far discussed?” (Behe, 1998 p 184)


No modern examples
No Modern Examples Nucleus

Unfortunately for Margulis and S.E.T. [the serial endosymbiotic theory], no modern examples of prokaryotic endocytosis or endosymbioses exist . . . She discusses any number of prokaryotes endosymbiotic in eukaryotes and uses Bdellovibrio as a model for prokaryotic endocytosis. Bdellovibrios are predatory (or parasitoid) bacteria that feed on E. coli by penetrating the cell wall of the latter and then removing nutrient molecules from E. coli while attached to the outer surface of its plasma membrane. Although it is perfectly obvious that this is not an example of one prokaryote being engulfed by another Margulis continually implies that it is.

P.J. Whitfield, review of “Symbiosis in Cell Evolution,” Biological Journal of the Linnean Society 18 [1982]:77-78; p 78)


Conclusions
Conclusions Nucleus

  • Presence of mitochondrial genes in nuclear DNA reduces the window of time available for mitochondrial acquisition in eukaryotes.

  • Understanding the structure of mitochondrial genes in the nucleus and how they are expressed makes the transfer of genes from protomitochondria to the nucleus appear complex.

  • Differences between mitochondrial genetic codes and nuclear genetic codes adds to the complexity of gene transfer between mitochondria and nucleus.

  • As molecular data accumulates, the endosymbiotic origin of mitochondria appears less probable.


Laboratory
Laboratory Nucleus


Pcr of human mtdna
PCR of Human mtDNA Nucleus

M

Single 460 bp mtDNA control region fragment which is polymorphic in sequence, but not size

Single nucleotide polymorphisms are common in the mtDNA control region. These can be used to identify remains and determine maternal linage due to the maternal inheritance of mitochondria


Human mtdna
Human mtDNA Nucleus

0

tRNA Pro

440 bp

fragment

0

1,260 Control region,

D-Loop,

Or hypervariable region

16,411

Right

primer

15,971

Left primer

16,569 bp


The amplified segment
The Amplified Segment Nucleus

gaaaaagtct ttaactccac cattagcacc caaagctaag

Attctaattt aaactattct ctgttctttc atggggaagc

agatttgggt accacccaag tattgactca cccatcaaca

accgctatgt atttcgtaca ttactgccag ccaccatgaa

tattgtacgg taccataaat acttgaccac ctgtagtaca

taaaaaccca atccacatca aaaccccctc cccatgctta

caagcaagta cagcaatcaa ccctcaacta tcacacatca

actgcaactc caaagccacc cctcacccac taggatacc

Acaaacctac ccacccttaa cagtacatag Tacataaagc

catttaccgt acatagcaca ttacagtcaa atcccttctc

Gtccccatgg atgacccccc tcagataggg gtcccttgac

caccatcctc cgtga


The amplified segment1
The Amplified Segment Nucleus

5’ctttaactccaccattagcacccaaagctaag…

5’ttaactccaccattagca3’

3’…tcagataggggtcccttgaccaccatcctccgt

3’ggaactggtggtaggagg5’

Following are what I suspect the primers to be:

  • Right Primer 5’ggaggatggtggtcaagg3’ TM 58.80

  • Left Primer 5’ttaactccaccattagca3’ TM 49.71


The amplified segment2
The Amplified Segment Nucleus

5’ctttaactccaccattagcacccaaagctaag…

cc3’

GC clamp at 3’ end?

…tcagataggggtcccttgaccaccatcctccgt3’

This would up TM and stabilize 3’ end of the primer

Following are what I suspect the primers to be:

  • Right Primer 5’ggaggatggtggtcaagg3’ TM 58.80

  • Left Primer 5’ttaactccaccattagca3’ TM 49.71

5’ttaactccaccattagca3’

3’ggaactggtggtaggagg5’


Human mtdna genes
Human mtDNA Genes Nucleus

  • Genes in human (for which numbers are given) and other mammalian mitochondria can be divided into three groups:

  • tRNA genes - 22

  • rRNA genes - 2

  • Protein coding genes - 13

  • Total genes = 37

  • All protein coding genes are involved in respiration

  • Aside from the coding portion of genes there is very little additional DNA except in the approximately 1,200 bp control region


John 1 12

Location Strand Length Gene Product Nucleus

3307..4263 + 318 ND1 NADH dehydrogenase subunit 1

4470..5513 + 347 ND2 NADH dehydrogenase subunit 2

5904..7445 + 513 COX1 cytochrome c oxidase subunit I

7586..8269 + 227 COX2 cytochrome c oxidase subunit II

8366..8572 + 68 ATP8 ATP synthase F0 subunit 8

8527..9207 + 226 ATP6 ATP synthase F0 subunit 6

9207..9989 + 260 COX3 cytochrome c oxidase subunit III

10059..10406 + 115 ND3 NADH dehydrogenase subunit 3

10470..10766 + 98 ND4L NADH dehydrogenase subun 4L

10760..12139 + 459 ND4 NADH dehydrogenase subunit 4

12337..14148 + 603 ND5 NADH dehydrogenase subunit 5

14149..14673 - 174 ND6 NADH dehydrogenase subunit 6

14747..15883 + 378 CYTB cytochrome b


John 1 12

The Nucleus

End