cells part iii n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Cells Part III PowerPoint Presentation
Download Presentation
Cells Part III

Loading in 2 Seconds...

play fullscreen
1 / 19
brook

Cells Part III - PowerPoint PPT Presentation

0 Views
Download Presentation
Cells Part III
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Cells Part III

  2. DNA Review • Nucleic acid • Double stranded helix • Monomer – nucleotide • Nucleotide – phosphate, deoxyribose sugar, nitrogenous base • Sugar phosphate backbone formed through bonds – what kind? • Each sugar attaches to 2 Phosphate confers directionality. • Nitrogenous bases interact via bond – what kind? Strong or weak? • www.ncbi.nlm.nih.gov/.../MolBioReview/dna2.htm

  3. DNA Review • A-T, C-G which are purines, which are pyrimidines? • Antiparallel orientation • Torsion in helix and stacking of bases produce major and minor grooves Minor Groove Major Groove ghr.nlm.nih.gov/.../illustrations/dnastructure

  4. Significance of DNA Structure • Maintenance of Code During Replication • A-T, C-G code retained during cell growth and division • Parent strands templates – code copied with fidelity • Provides Variety • Gene sequence of bases, genome collection of all DNA bases – responsible for uniqueness

  5. DNA Replication • Duplication of DNA molecule – passed to progeny • How does it begin? • Signal triggers cell machinery – duplication of chromosome, in which phase? • Must occur in 1 life cycle • E. coli – once every 20 mins.

  6. Enzymes of DNA Replication • Helicases - untwist and separate DNA strands • Topoisomerases - prevent breakage of DNA strands at fork due to torsion generated • Primase- RNA primer • DNA polymerase III – begins synthesis at primer • DNA polymerase I – chews up primer, replaces with DNA • DNA ligase – attaches fragments • Requires ~30 enzymes

  7. DNA Replication • Begins at Ori • Helicases – unwind DNA and break apart two strands • Topoisomerases – prevent breaking • Each strand will be used as a template http://faculty.ircc.edu/FACULTY/TFischer/bio%201%20files/bio%201%20resources.htm

  8. DNA Replication • Begins at Ori with RNA primer – primase • DNA pol III adds bases - Elongation -Synthesis of 2 daughter strands using template by DNA pol III in 5’ -> 3’ direction • Semiconsevative process • EXAMPLE: Give complementary strand 5’ AACTGCATGGGCCATTTTAAG 3’ TTGACGTACCCGGTAAAATTC http://faculty.ircc.edu/FACULTY/TFischer/bio%201%20files/bio%201%20resources.htm

  9. DNA Replication • Leading and Lagging strand formed at each fork • Leading continuously formed • Lagging uses primer every 100-1000 bases to synthesis new fragment. • Okazaki fragments • DNA Pol I removes primer and adds bases • DNA ligase joins fragments • Forks meet ligase joins strands - termination http://lcvmwww.epfl.ch/~lcvm/dna_teaching_08_09/course_files/stasiak.html

  10. Central Dogma of Molecular Biology • Genome full of info, but DNA does not perform cell processes • Exceptions – RNA viruses www.phschool.com/.../transcription/overview.html

  11. Gene – Protein Connection • 3 Categories of Genes 1) Structural – protein 2) genes code for RNA 3) Regulatory – control gene expression - all three make up genotype (DNA) • Expressing of these make up phenotype • Review-Gene is DNA seq -> protein (a.a seq)-> 1 specific function (phenotype)

  12. RNA • ss molecule, helix form, can form 2° and 3° structures due to H-bonds w/in molecule • U instead of T • Ribose instead of Deoxyribose • All RNA formed through Transcription, only mRNA Translated http://biology.kenyon.edu/courses/biol63/ribo/ribo.html

  13. Types of RNA • mRNA- messenger RNA -transcript (copy) of gene -message read as triplets called codon 2) tRNA-transfer RNA -carries a.a. to ribosomes during translation -cloverleaf, 3 loops -bottom loop, anticodon 3) rRNA + protein = ribosome site of translation

  14. Transcription: DNA -> RNA • Eukaryotes occurs in nucleus – Where is DNA? • Initiation – RNA polymerase recognizes and binds promoter region on DNA. • Elongation – DNA unwinds, RNA Pol synthesizes RNA molecule in 5’->3’ direction. • Termination – RNA Pol recognizes another seq. and releases DNA and mRNA transcript http://faculty.ircc.edu/faculty/tfischer/micro%20resources.htm

  15. Reading the Message • mRNA encodes for a.a. sequence • Code is universal • Triplet = codon, 64 codons code for 20 a.a. 5’ AUG GUU CCC UAA 3’

  16. Reading the Message • AUG is start codon • Example of mRNA: How many a.a.? 5’ AAAUGUUUCAAAAAUAAGA 3’ 4 – Methionine, Phenalanine, Glutamine, Lysine, Stop

  17. Translation: mRNA -> Protein • Occurs at ribosomes in cytoplasm • Initiation: mRNA leaves DNA site, transported to ribosome 1) small subunit 30s binds mRNA, scans 5’->3’ for start codon 2) 1st charged tRNA carries fMet -Binds to mRNA via anticodon loop 3) large subunit 50s binds complex, provide enzymes that form peptide bonds, fMet in P site library.thinkquest.org/.../rna/index.html

  18. Translation: mRNA -> Protein • Elongation: 1) 2nd charged tRNA enters A site, peptide bond formed 2) Complex shifts, uncharged tRNA leaves, open A site 3) next charged tRNA enters https://eapbiofield.wikispaces.com/17.2+and+17.4+Smith

  19. Translation: mRNA -> Protein • Termination: Process repeated until stop codon, disassociation • Polyribosomes • Nearly 1200 ATP required for avg. protein http://kvhs.nbed.nb.ca/gallant/biology/translation_termination.html