brendan-powers
Uploaded by
10 SLIDES
259 VIEWS
100LIKES

blast

DESCRIPTION

blast. The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates

1 / 10

Download Presentation

blast

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. blast The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches.BLAST can be used to infer functional and evolutionary relationships between sequencesas well as help identify members of gene families.

  2. Query: 1 tatctggttgatcctgccagtattatatgctgatgttagagattaagccatgcatgtgta 60 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1 tatctggttgatcctgccagtattatatgctgatgttaaagattaagccatgcatgtgta 60 Query: 61 agtataaagaccaagtaggatgaaactgcggacggctcattataacagtaatagtttctt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 agtataaagaccaagtaggatgaaactgcggacggctcattataacagtaatagtttctt 120 Query: 121 tggttagtaaagtacaaggatagctttgtgaatgataaagataatacttgagacgatcca 180 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 tggttagtaaaatacaaggatagctttgtgaatgataaagataatacttgagacgatcca 180 Query: 181 atttgtattagtacaaagtggccaatttatgtaagtaaattgagaaatgacattctaagt 240 |||||||||||||||| ||||||||| || || | ||||||||||||||||||||||| Sbjct: 181 gtttgtattagtacaaaatggccaattcattcaa-tgaattgagaaatgacattctaagt 239 Query: 241 gagttaggatgccacgacaattgtagaacacacagtgtttaacaagtaaccaatgagaat 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 240 gagttaggatgccacgacaattgtagaacacacagtgtttaacaagtaaccaatgagaat 299

  3. Query: 961 gttaggggatcgaagacgatcagataccgtcgtagtcctaactataaacgatgtcaacca 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 960 gttaggggatcgaagacgatcagataccgtcgtagtcctaactataaacgatgtcaacca 1019 Query: 1021 aggattggatgaaattcagatgtacaaagatgaagaaacattgtttctaaatccaagtat 1080 ||||||||||||||||||||||||||||||| |||| ||||||||||| ||| ||||| Sbjct: 1020 aggattggatgaaattcagatgtacaaagatagagaagcattgtttctagatctgagtat 1079 Query: 1081 atcaatactaccttgttcagaacttaaagagaaatcttgagtttatggacttcaggggga 1140 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1080 atcaatattaccttgttcagaacttaaagagaaatcttgagtttatggacttcaggggga 1139

More Related