Novel Electrochemical Detection System for Potassium Ion and Glutamate in E. coli
80 likes | 176 Views
This proposal presents a concept using induced pumps and channels for detecting and measuring changes in K+ ion and glutamate concentrations in E. coli. Steps involve chassis selection, creating potential differences, ligand detection, and measuring potential changes. Testing on mutant E. coli, over-expressing pumps, and introducing new channels is detailed. Further developments aim to amplify responses and detect multiple ligands.
Novel Electrochemical Detection System for Potassium Ion and Glutamate in E. coli
E N D
Presentation Transcript
Biotricity Cambridge iGEM2008 Project Proposal
Glutamate K+ K+ neutral relative to medium E.coli Concept Inducible pump K+ Constitutive channel +ve relative to medium E.coli
Steps • Step 1 – Chassis selection • Step 2 – Setting up a potential difference between culture and external constant potential/ground • Step 3 – Detection of ligand and change in potential • Step 4 – Measurement of PD change
Step 1 - Chassis Escherichia coli mutant: • Insensitive to glutamate • No Kch channels expressed Testing: • Glutamate on semi-solid agar plate • Immunoglobulin antibody precipitate test for Kch protein
Step 2 - Setting up a PD Over-express Kdp (potassium pump): • Kdp operon native to E.coli • Adjust regulation Testing: • ELISA assay to measure Kdp protein production • Or measure K+ concentration/ PD • Or mass spectrometry, comparing peak intensities • Or 2D PAGE New
Step 3 - Detection of ligand New Glutamate-gated K+ channel: • Already sequenced, from Granulobacter bethesdensis • Synthesise using • Transform into chassis Ttgacaccgtttttttctaacgctttcagacgccctctccgttctgtgtttaggctctgtttccttctgttctccatactggctcaggcaggcttgatgggagtcgtcctccctcctgcccatgctatggcagcggataaaaataccgccgagcatggtgtaatcaatgcaggctattttatcgatccgcctttcgtgctgccgcatcagaagaatgatcatccggccgggctggccattgatctatgggacaagacgtcacagatgcagggctggatcacccattatcaccgctatgaaacgatagccgatcttctctccgctcttgagcgcggggagatcgatgtcggtacggtcggcctgacaatcagcagccagcgtatggagaaagtgatcttcagccagccctggtttcagaccgggctgcggatgatgatcgtcaaacacaatagtaccggcctttccagacttctgagcgaactggctgcttccggccatctgcgtaactatttgttgatttttctggcgatcctggtggcga xxxxxxxxxxxxxxxcactgatcacagccatcatgcaccggcatgtgttgaaggattcatcaccccactggagttcctctctgtcgggcgccttc xxxxxxxxxxxxxxxxxxxxxxxtatgatatgatggcgatgctgaccggcaatcaaacgtccggcaccgtgccagagcgagccggtgcacg xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatcattgccgccatctggctgctctgtggcgttggcattgtggcctatgtcacatccagcat xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaccagcgtgatgacggcttcagaaatcaatcagcgcgtggacaatatcactg xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaactaggccatcgcccggtcagtgcgatgaaaggcagcatcgccatga xxxxxxxxxxxxxxxxxxxxxxxxcttttgccttggataccggcctgaacgttcacggatatacgctcctgtccgatgctgtagatgaactgatcc xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagggcaaaacatccgccattctgggagatgcatcacagctcgattattatatccaacaga xxxxxxxxxxxxxxxxxxxxxxxxxaccccacccaatcactgatcgtaacaggcgctacactacgtccggaaaatctcggcttcgtcatgcggcccggtttccctatgcgttatcagatcgacaggaccattctcaagttgcaggaagaaaaaatcctgtcccagatggagtctgcctatttttcacatcgataa
Step 4 - Measurement Look, Engineering! • Sensitive electrode in culture • Other electrode at known potential (could be ground)
Further Developments 1) Amplify response: • Separate receptor and gated K+ channel • Connect via intracellular signalling pathway 2) Detect other or multiple ligands