Download
do now 2 27 n.
Skip this Video
Loading SlideShow in 5 Seconds..
DO Now- 2/27 PowerPoint Presentation
Download Presentation
DO Now- 2/27

DO Now- 2/27

0 Views Download Presentation
Download Presentation

DO Now- 2/27

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. DO Now- 2/27 • Blonde hair is dominant to blonde hair. A heterozygous female is crossed with a heterozygous male… Punnett’s Square and phenotype/genotype ratios OR • What is DNA? OR • Where is DNA found?

  2. TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Zebrafish booklets and test: last day TODAY!

  3. DNA(Deoxyribonucleic Acid)

  4. Genetic material of cells… • GENES – units of genetic material that CODES FOR A SPECIFIC TRAIT • Called NUCLEIC ACIDS • DNA is made up of repeating molecules called NUCLEOTIDES

  5. DNA STRUCTURE • DNA had specific pairing between the nitrogen bases: • ADENINE (A) – THYMINE (T) • CYTOSINE (C) – GUANINE (G) • “Complementary Rule”:DNA made of 2 long stands of nucleotides arranged in a specific way

  6. Nucleotides – DRAW THIS!!! Phosphate Nitrogenous Base (A, T, C, G) Sugar

  7. A or G T or C Nitrogenous Bases • PURINES 1. Adenine (A) 2. Guanine (G) • PYRIMIDINES 3. Thymine (T) 4. Cytosine (C)

  8. “Rungs of ladder” Nitrogenous Base (A,T,G or C) “Legs of ladder” Phosphate & Sugar Backbone DNA Double Helix

  9. 5 O 3 3 O P P 5 5 C O G 1 3 2 4 4 2 1 3 5 O P P T A 3 5 O O 5 P P 3

  10. C T A G Chargaff’s Rule • Adeninemust pair with Thymine • Guanine must pair with Cytosine • Their amounts in a given DNA molecule will be about the same.

  11. H-bonds G C A T BASE-PAIRINGS

  12. DNA Structure Review Questions • What does DNA stand for? • DNA is made of repeating units of __________________ • A nucleotide is made of: …? • Draw a nucleotide. • What are the 4 nitrogenous bases? • What are the two PURINES? Are they Big or little?

  13. DO Now- 2/28 • What makes up DNA? OR • Draw a picture of what DNA looks like? OR • What are the 4 bases?

  14. TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Students Run Quiz Thursday

  15. A HISTORY OF DNA • Discovery of the DNA double helix A. Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless bacteria into deadly bacteria (1928) B. Rosalind Franklin- X-ray photo of DNA. (1952) C. Watson and Crick- described the DNA molecule from Franklin’s X-ray. (1953)

  16. History Continued • Hershey & Chase– • 1952, proved DNA determined proteins • Used bacteria and bacteria viruses to show DNA responsible for heredity • Chargaff—Chargaff’s rules. • Using ratio of nitrogenous bases in DNA, showed complimentary bases.

  17. Genetic Diversity… • Different arrangements of NUCLEOTIDES in a nucleic acid (DNA) provides the key to DIVERSITY among living organisms.

  18. The Code of Life… • The “code” of the chromosome is the SPECIFIC ORDER that bases occur. A T C G T A T G C G G…

  19. DNA is wrapped tightly around histones and coiled tightly to form chromosomes See p. 297

  20. Questions: • Complete the questions on page 202 on a separate piece of paper (1 – 11). Please write the question and just your answer. • Skip question 2 and 10 • #5  just the definitions of the 3 words

  21. Do Now – 3 /19 • What is the structure of DNA? OR • What are nucleotide bases?

  22. STEP 1: Helicase unwinds, unzips STEP 2: DNA polymerase adds bases as it reads strand (leading and lagging strand) STEP 3: Ligase checks and binds all fragments together (finishing touch)

  23. DNA Replication • DNA must be copied • The DNA molecule produces 2 IDENTICAL new complementary strands following the rules of base pairing: A-T, G-C • Replicates using the enzyme DNA polymerase

  24. DNA Template Parental DNA New DNA DNA Replication • Semiconservative Model: 1.Watson and Crick showed: the two strands of the parental molecule separate, and each functions as a template for synthesis of a new complementary strand. .

  25. DNA Polymerase – Enzyme for DNA Replication • Reads original strand 3’  5’ • New strand created 5’  3’ • DNA Helicase – Enzyme that unwinds the DNA

  26. DRAW THIS!!!!!!!!!

  27. (1961) Watson & Crick proposed… • …DNA controlled cell function by serving as a template for PROTEINstructure. • 3 Nucleotides = a triplet or CODON (which code for a specific AMINO ACID) • AMINO ACIDS are the building blocks of proteins.

  28. Replication – Checking for Understanding 1. Why is replication necessary? 2. Who proposed the replication concept? 3. What is the replication process called? • Use the complementary rule to create the complementary strand: A---? G---? C---? T---? A---? G---? A---? G---? C---? A---? G---? T---?

  29. Questions: • Answer the questions on page 200 (section 3 review) in your notebook • I will check and grade them before you leave.

  30. DNA Replication Review Question • Draw a picture of DNA replication at the replication fork. • What are the 2 enzymes involved in replication? • What is DNA replication called (the name of the model proposed by Watson and Crick)? • What is the difference between the leading and lagging strands? • What is the complementary strand to the following: ATTAGCTAGGACT

  31. EXIT TICKET 1. Draw a picture of a DNA strand. 2. Write the complementary strand to the following: AAATTTCCCGGG

  32. Do Now – 3/9 • What are the 3 parts of DNA • What are the two enzymes in DNA replication? • What is the shape of DNA CHOOSE ONE!!!!!!!

  33. CLASSWORK 3/9 • Define the words on page 221 on back of worksheet (Section 1 vocab) • Any 6 questions from the worksheet • Chapter 9

  34. Classwork: • Turn to page 202 in the Biology textbook • One a SEPARATE SHEET OF PAPER: • Answer questions 2, 4, 5, and 8-15 • You MUST write the question

  35. Do Now – 4/10 • What are the 3 parts of DNA • What are the 3 steps in DNA replication • What are the steps of transcription? CHOOSE ONE!!!!!!!

  36. DNA RNA Protein Transcription and Translation: An Overview (aka the Central Dogma) Transcription – in nucleus Translation – in cytoplasm, on ribosomes

  37. DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U RNA vs. DNA Both contain a sugar, phosphate, and base.

  38. DNA can “unzip” itself and RNA nucleotides match up to the DNA strand. • Both DNA & RNA are formed from NUCLEOTIDES and are called NUCLEIC acids.

  39. Transcription • DNA  RNA • Happens in the NUCLEUS • RNA forms base pairs with DNA • C-G • A-U • mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

  40. RNA polymerase- complex of enzymes, like DNA polymerase STEP 1: RNA Primer binds to the parent DNA strand before gene to be transcribed • STEP 2: Unwind DNA sequence (RNA Polymerase) • STEP 3: Produce primary transcript by stringing together the chain of RNA nucleotides (RNA Polymerase)

  41. mRNA Processing • Primary transcript is not mature mRNA • DNA sequence has coding regions (exons) and non-coding regions (introns) • Introns must be spliced out before mRNA can leave nucleus

  42. TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG GGG ACU UGC UAU

  43. Classwork: 1. In your notebook, fill out the two charts below with 3 facts in each box: 2. What is RNA polymerase? 3. What would be the corresponding mRNA sequence for the following DNA strand: ATTCGATTCGATATACTAGCTAGCT

  44. Do Now 4/11 1. What is RNA polymerase? OR 2. What would be the corresponding mRNA sequence for the following DNA strand: ATTCGATTCGATATACTAGCTAGCT

  45. Q4 Project: Genetic Disease In your visual: Can be a powerpoint, poster, brochure, etc. Aesthetics do count!!! Should have pictures and info In your paper: • 2 pages single spaced handwritten • 2 pages double spaced typed • You MUST include a bibliography of 3 sources (Textbook is ok)

  46. Q4 Project: Genetic Disease In your visual: Pictures of disease (if appropriate) Major information in bullet point format Should include all information outlined in your paper • In your paper: • Symptoms and problems associated • How it is passed through generations (dominant, recessive, sex linked) • When it was discovered, how it was discovered, and by whom (which scientists) • Outcomes and treatments

  47. DUE DATES • Disease Choice: TODAY (10 Points) look on page 181 for ideas (if you have another make sure I clear it first • Rough Draft Due: Friday, April 20th (40 Points) • Final (Visual and Paper):Friday, April 27th (150 Points) • TOTAL: 200 Points, Test Grade

  48. Q4 Project: Genetic Disease • RUBRICS

  49. Do Now 4/12 1. What are the 4 steps in transcription? OR 2. Compare DNA and RNA.