slide1
Download
Skip this Video
Download Presentation
Carlo Colantuoni – [email protected]

Loading in 2 Seconds...

play fullscreen
1 / 131

Carlo Colantuoni – [email protected] - PowerPoint PPT Presentation


  • 106 Views
  • Uploaded on

Summer Inst. Of Epidemiology and Biostatistics, 2008: Gene Expression Data Analysis 8:30am-12:30pm in Room W2017. Carlo Colantuoni – [email protected] http://www.biostat.jhsph.edu/GenomeCAFE/GeneExpressionAnalysis/GEA2008.htm. Class Outline.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Carlo Colantuoni – [email protected]' - booker


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Summer Inst. Of Epidemiology and Biostatistics, 2008:Gene Expression Data Analysis8:30am-12:30pm in Room W2017

Carlo Colantuoni – [email protected]

http://www.biostat.jhsph.edu/GenomeCAFE/GeneExpressionAnalysis/GEA2008.htm

class outline
Class Outline
  • Basic Biology & Gene Expression Analysis Technology
  • Data Preprocessing, Normalization, & QC
  • Measures of Differential Expression
  • Multiple Comparison Problem
  • Clustering and Classification
  • The R Statistical Language and Bioconductor
  • GRADES – independent project with Affymetrix data.

http://www.biostat.jhsph.edu/GenomeCAFE/GeneExpressionAnalysis/GEA2008.htm

class outline detailed
Class Outline - Detailed
  • Basic Biology & Gene Expression Analysis Technology
    • The Biology of Our Genome & Transcriptome
    • Genome and Transcriptome Structure & Databases
    • Gene Expression & Microarray Technology
  • Data Preprocessing, Normalization, & QC
    • Intensity Comparison & Ratio vs. Intensity Plots (log transformation)
    • Background correction (PM-MM, RMA, GCRMA)
    • Global Mean Normalization
    • Loess Normalization
    • Quantile Normalization (RMA & GCRMA)
    • Quality Control: Batches, plates, pins, hybs, washes, and other artifacts
    • Quality Control: PCA and MDS for dimension reduction
  • Measures of Differential Expression
    • Basic Statistical Concepts
    • T-tests and Associated Problems
    • Significance analysis in microarrays (SAM) [ & Empirical Bayes]
    • Complex ANOVA’s (limma package in R)
  • Multiple Comparison Problem
    • Bonferroni
    • False Discovery Rate Analysis (FDR)
  • Differential Expression of Functional Gene Groups
    • Functional Annotation of the Genome
    • Hypergeometric test?, Χ2, KS, pDens, Wilcoxon Rank Sum
    • Gene Set Enrichment Analysis (GSEA)
    • Parametric Analysis of Gene Set Enrichment (PAGE)
    • geneSetTest
    • Notes on Experimental Design
  • Clustering and Classification
    • Hierarchical clustering
    • K-means
    • Classification
      • LDA (PAM), kNN, Random Forests
      • Cross-Validation
  • Additional Topics
    • The R Statistical Language
    • Bioconductor
    • Affymetrix data processing example!
day 2

DAY #2:

  • Intensity Comparison & Ratio vs. Intensity Plots
  • Log transformation
  • Background correction (Affymetrix, 2-color, other)
  • Normalization: global and local mean centering
  • Normalization: quantile normalization
  • Batches, plates, pins, hybs, washes, and other artifacts
  • QC: PCA and MDS for dimension reduction
slide5
Microarray Data Quantification

Log Intensity

Log Intensity

slide6
Microarray Data Quantification

Log Ratio

Log Intensity

slide7
Logarithmic Transformation:

if : logz(x)=y

then : zy=x

Logarithmmath refresher:

log(x) + log(y) = log( x * y )

log(x) - log(y) = log( x / y )

slide8
Intensity vs. Intensity: LINEAR

Intensity Distribution: LINEAR

slide9
Intensity vs. Intensity: LOG

Intensity Distribution:LOG

slide12
Microarray Data Quantification

Int vs. Int:LINEAR

Int vs. Int:LOG

Ratio vs. Int: LOG

before hybridization
Before Hybridization

Sample 1

Sample 2

Array 2

Array 1

after hybridization
After Hybridization

Array 2

Array 1

more realistic before
More Realistic - Before

Sample 1

Sample 2

Array 2

Array 1

slide18
No label

poly C

slide19
Intensity distributions for the

no-label and Yeast DNA

slide20
Why Adjust for Background?

The presence of background noise is clear from the fact that the minimum PM intensity is not 0 and that the geometric mean of the probesets with no spike-in is around 200 units.

why adjust for background
Why Adjust for Background?

(E1 + B) ≈ E1 or …

(E1 + B) / (E2 + B) ≈ E1 / E2

Local slope decreases as nominal concentration decreases!

(E1 + B) ≈ B or …

(E1 + B) / (E2 + B) ≈ 1

By using the log-scale transformation before analyzing microarray data, investigators have, implicitly or explicitly, assumed a multiplicative measurement error model (Dudoit et al., 2002; Newton et al., 2001; Kerr et al., 200; Wolfinger et al., 2001). The fact, seen in Figure 2, that observed intensity increase linearly with concentration in the original scale but not in the log-scale suggests that background noise is additive with non-zero mean. Durbin et al. (2002), Huber et al. (2002), Cui, Kerr, and Churchill (2003), and Irizarry et al. (2003a) have proposed additive-background-multiplicative-measurement-error models for intensities read from microarray scanners.

affymetrix genechip design
Affymetrix GeneChip Design

5’

3’

Reference sequence

…TGTGATGGTGCATGATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT…

GTACTACCCAGTCTTCCGGAGGCTA

Perfectmatch (PM)

Mismatch (MM)

GTACTACCCAGTGTTCCGGAGGCTA

NSB & SB

NSB

affymetrix genechip design1
Affymetrix GeneChip Design

5’

3’

Reference sequence

…TGTGATGGTGCATGATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT…

GTACTACCCAGTCTTCCGGAGGCTA

Perfectmatch (PM)

Mismatch (MM)

GTACTACCCAGTGTTCCGGAGGCTA

NSB & SB

NSB

motivation pm mm
Motivation: PM - MM

The hope is that:

PM = B + S

MM = B

PM – MM = S

But this is not correct!

simulation
Simulation
  • We create some feature level data for two replicate arrays
  • Then compute Y=log(PM-kMM) for each array
  • We make an MA using the Ys for each array
  • We make a observed concentration versus known concentration plot
  • We do this for various values of k. The following “movie” shows k moving from 0 to 1.
slide30
k=0

Log2(Ratio)

Observed level (log2)

Log2(Intensity)

Known level (log2)

k 1 4
k=1/4

Log2(Ratio)

Observed level (log2)

Log2(Intensity)

Known level (log2)

k 1 2
k=1/2

Log2(Ratio)

Observed level (log2)

Log2(Intensity)

Known level (log2)

k 3 4
k=3/4

Log2(Ratio)

Observed level (log2)

Log2(Intensity)

Known level (log2)

slide34
k=1

Log2(Ratio)

Observed level (log2)

Log2(Intensity)

Known level (log2)

real data
Real Data

MAS 5.0

RMA

rma the basic idea
RMA: The Basic Idea

PM=B+S

Observed: PM

Of interest: S

Pose a statistical model and use it to predict S from the observed PM

the basic idea
The Basic Idea

PM=B+S

  • A mathematically convenient, useful model
    • B ~ Normal (,)

S ~ Exponential ()

    • No MM
    • Borrowing strength across probes
slide40
RMA

Notice improved precision but worse accuracy

problem
Problem
  • Global background correction ignores probe-specific NSB
  • MM have problems
  • Another possibility: Use probe sequence
slide43
G-C content effect in PM’s

Any given probe will have some propensity to non-specific binding. As described in Section 2.3 and demonstrated in Figure 3, this tends to be directly related to its G-C content. We propose a statistical model that describes the relationship between the PM, MM, and probes of the same G-C content.

Boxplots of log intensities from the array hybridized to Yeast DNA for strata of probes defined by their G-C content. Probes with 6 or less G-C are grouped together. Probes with 20 or more are grouped together as well. Smooth density plots are shown for the strata with G-C contents of 6,10,14, and 18.

general model gcrma
General Model (GCRMA)

NSB

SB

We can calculate:

Due to the associated variance with the measured MM intensities we argue that one data point is not enough to obtain a useful adjustment. In this paper we propose using probe sequence information to select other probes that can serve the same purpose as the MM pair. We do this by defining subsets of the existing MM probes with similar hybridization properties.

slide45
The MA plot shows log fold change as a function of mean log expression level. A set of 14 arrays representing a single experiment from the Affymetrix spike-in data are used for this plot. A total of 13 sets of fold changes are generated by comparing the first array in the set to each of the others. Genes are symbolized by numbers representing the nominal log2 fold change for the gene. Non-differentially expressed genes with observed fold changes larger than 2 are plotted in red. All other probesets are represented with black dots. The smooth lines are 3SDs away with SD depending on log expression.
slide47
Another sequence effect in PM’s and MM’s

Naef & Magnasco (2003),

PHYSICAL REVIEW E 68, 011906, 2003

slide48
Another sequence effect in PM’s and MM’s

We show in Fig. 2 joint probability distributions of PMs and MMs, obtained from all probe pairs in a large set of experiments. Actually, two separate probability distributions are superimposed: in red, the distribution for all probe pairs whose 13th letter is a purine, and in cyan those whose 13th letter is a pyrimidine. The plot clearly shows two distinct branches in two colors, corresponding to the basic distinction between the shapes of the bases: purines are large, double ringed nucleotides while pyrimidines have smaller single rings. This underscores that by replacing the middle letter of the PM with its complementary base, the situation on the MM probe is that the middle letter always faces itself, leading to two quite distinct outcomes according to the size of the nucleotide. If the letter is a purine, there is no room within an undistorted backbone for two large bases, so this mismatch distorts the geometry of the double helix, incurring a large steric and stacking cost. But if the letter is a pyrimidine, there is room to spare, and the bases just dangle. The only energy lost is that of the hydrogen bonds.

Naef & Magnasco (2003),

PHYSICAL REVIEW E 68, 011906, 2003

another sequence effect in pm s
Another sequence effect in PM’s

The asymmetry of (A,T) and (G,C) affinities in Fig. 3 can be explained because only A-U and G-C bonds carry labels ~purines U and C on the mRNA are labeled. Notice the nearly equal magnitudes of the reduction in both type of bonds. (Remember also that G-C pairs have 3 and A-T pairs have 2 hydrogen bonds!).

Naef & Magnasco (2003), PHYSICAL REVIEW E 68, 011906, 2003

two color platforms agilent cdna
Two color platforms (Agilent, cDNA)
  • Common to have just one feature per gene
  • 60 vs. 25 NT?
  • Optical noise still a concern
  • After spots are identified, a measure of local background is obtained from area around spot

(this is also applicable to some spotted one-channel data)

local background
Local background

---- GenePix

---- QuantArray

---- ScanAnalyze

two color feature level data
Two color feature level data
  • Red and Green foreground and background obtained from each feature
  • We have Rfgij, Gfgij, Rbgij, Gbgij (g is gene, i is array and j is replicate)
  • A default summary statistic is the log-ratio:

log2 [(Rf-Rb) / (Gf - Gb)]

background subtraction
Background subtraction

No background subtraction

two color platforms
Two color platforms
  • Again, we can assess the tradeoff of accuracy and precision via simulation
  • Simulation uses a self versus self (SVS) hybridization experiment -- no differential expression should occur.
  • Mean squared error (MSE) = bias^2 + variance.
slide60
Background Subtraction: Conclusions
  • A procedure that subtracts local background as a function of the correlation of fg and bg ratios may be a nice compromise between background subtraction and no background subtraction.
  • For references, see background subtraction paper by C. Kooperberg J Computational Biol 2002.
  • Limma package in R has many useful functions for background subtraction.
  • Following the decision to background subtract, we need to consider a normalization algorithm.
normalization
Normalization
  • Normalization is needed to ensure that differences in intensities are indeed due to differential expression, and not some printing, hybridization, or scanning artifact.
  • Normalization is necessary before any analysis which involves within or between slides comparisons of intensities, e.g., clustering, testing.
  • Somewhat different approaches are used in two-color and one-color technologies
slide66
Distributions of intensities after global mean normalization – global mean normalization is not enough …Possible solutions:Local Mean NormalizationQuantile Normalization
slide67
Local Mean Normalization (loess):Adjusts for intensity-dependent bias in ratios.Requires Comparison!
quantile normalization
Quantile normalization
  • All these non-linear methods perform similarly
  • Quantiles is commonly used because its fast and conceptually simple
  • Basic idea:
    • order value in each array
    • take average across probes
    • Substitute probe intensity with average
    • Put in original order
example of quantile normalization
Example of quantile normalization

Original

Ordered

Averaged

Re-ordered

after quantile normalization
After Quantile Normalization

A worry is that it over corrects

images of probe level data
Images of probe level data

This is the raw data

images of probe level data1
Images of probe level data

Residuals (or weights) from probe level model fits show problem clearly

slide99
PCA, MDS, and Clustering:

Dimension Reduction to Detect Experimental Artifacts and Biological Effects

slide100
Principle Components Analysis (PCA)

and

Multi-Dimensional Scaling (MDS)

slide108
Much Like

Red:Green Analysis

Removing The Batch Effect

slide121
AGE

RNA Quality

slide122
AGE

Batch

slide124
Biological Effects:

Tissue Types and Growth Factor Treatments

ad