120 likes | 164 Views
Explore the covariance in RNA sequences to analyze lab evolution, co-growth, and co-evolution of biosensors. Discover the genetic adaptations and genomic changes in bacterial evolution.
E N D
1 72 " " Covariance in RNA ref
Covariance TyC anticodon 3’acc D-stem Mij= Sfxixjlog2[fxixj/(fxifxj)] M=0 to 2 bits; x=base type xixjsee Durbin et al p. 266-8.
Mutual Information ACUUAU M1,6= S = fAU log2[fAU/(fA*fU)]... CCUUAGx1x6 GCUUGC =4*.25log2[.25/(.25*.25)]=2 UCUUGA i=1j=6M1,2= 4*.25log2[.25/(.25*1)]=0 Mij= Sfxixjlog2[fxixj/(fxifxj)] M=0 to 2 bits; x=base type xixjsee Durbin et al p. 266-8. See Shannon entropy, multinomial Grendar
Covariance in lab evolution Second Passage First Passage trp/tyrA pair of genomes shows the best co-growth Reppas, Lin & Church ; Shendure et al. Accurate Multiplex Polony Sequencing of an Evolved Bacterial Genome(2005) Science 309:1728
Sequence monitoring of evolution(optimize transport & drug resistance) Sequence Reppas, Lin & Church
Co-evolution of mutual biosensors/biosynthesissequenced across time & within each time-point Independent lines of TrpD & TyrD co-culture 5 OmpF: (pore: large,hydrophilic > small) 42R-> G,L,C, 113 D->V, 117 E->A 2 Promoter: (cis-regulator) -12A->C, -35 C->A 5 Lrp: (trans-regulator) 1bD, 9bD, 8bD, IS2 insert, R->L in DBD. Heterogeneity within each time-point . Shendure J, Porreca GJ, et al. 2005. Accurate multiplex polony sequencing of an evolved bacterial genome. Science 309: 1728-32
Flux ratios at each branch point yields optimal polymer composition for replication x,y are two of the 100s of flux dimensions
Non-optimal evolves to optimal Ibarra et al.Nature. 2002 Nov 14;420(6912):186-9. Escherichia coli K-12 undergoes adaptive evolution to achieve in silico predicted optimal growth.
Comparative genome sequencing of E. coli allows observation of bacterial evolution on a laboratory timescale. Herring et al 2006 Nat. Gen 38:1406
The Amino-acid Mutational Spectrum of Human Genetic Disease. Vitkup,D, Sander,C, Church,GM (2003) Genome Biol. 4: R72.
Prediction of deleterious human alleles Shamil Sunyaev, Vasily Ramensky, Ina Koch, Warren Lathe III, Alexey S. Kondrashov, and Peer Bork Hum Mol Genet (2001) 10: 591-597 http://genetics.bwh.harvard.edu/pph/ http://polydoms.cchmc.org/polydoms/
Prediction Puzzles >example1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC