slide1
Download
Skip this Video
Download Presentation
*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment

Loading in 2 Seconds...

play fullscreen
1 / 4

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment - PowerPoint PPT Presentation


  • 135 Views
  • Uploaded on

Frameshift. *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment. *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment. Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment' - betha


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1
Frameshift

*** CTGGGAGATTATGGCTTTAAG***

*** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment

*** CTG GGA GAT TAT GGC TTT AAG

*** CTG GGA TAA G codon alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly STOP G translation

slide2
Silent

*** CTG GGA GAT TAT GGC TTT AAG***

*** CTG GGA GAT TAT GGC TTC AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Phe Lys translation

slide3
Missense

*** CTG GGA GAT TAT GGC TTT AAG***

*** CTG GGA GAT TAT GGC TAT AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp Tyr Gly Tyr Lys translation

slide4
Nonsense

*** CTG GGA GAT TAT GGC TTT AAG***

*** CTG GGA GAT TAG GGC TTT AAG*** alignment

Leu Gly Asp Tyr Gly Phe Lys

Leu Gly Asp STOP translation

ad