140 likes | 273 Views
killer vegetables, animal-human hybrids, other scary stuff. KEVIN HIOM. Galway 2010. Chapter 1: Epistasis for beginners. Basic principles of DT40. DT40: A genetically tractable eukaryotic cell line. DT40. Genetically tractable Good model for genome stability in mammals
E N D
killer vegetables, animal-human hybrids, other scary stuff. KEVIN HIOM Galway 2010 Chapter 1: Epistasis for beginners Basic principles of DT40
DT40: A genetically tractable eukaryotic cell line DT40 • Genetically tractable • Good model for genome stability in mammals • Complementation by human genes • Good database versus humans
Genetically tractable DT40 Phenotypic analysis Knocking out or mutating genes and looking at cellular function Mapping genetic pathways Combining mutations- epistasis Structure/function analysis/ cell biology Complementation, proteomics Genetic regulation Reporter assays All these require manipulation of the genome
Integrate DNA Target DNA * Alter DNA * Remove DNA
Genetic Recombination is our tool Random Integration- non homologous end joining Targeted Integration- Homologous/Homeologous recombination Site specific recombination
Non Homologous End Joining-Random integration Ku, DNA-PKcs, LigIV, Advantages Disadvantages Simple Relatively high frequency Potential uncharacterised genetic effect Multiple integration Shut down of expression
Homologous recombination- site specific integration, gene disruption, mutation DNA End Resection Mre11/RAD50/NBS1, CtIP, Exo1 Strand Invasion RAD51 Branch Migration RAD51BCD Holliday Junctions Resolution Slx1/4, GEN1
Homologous Recombination Advantages Acurate/error free Introduction of multiple changes Disdvantages Easy to introduce errors Aberrant recombination Neighbouring sequences Epistasis difficult for HR genes
Site specific recombination- cre/lox ATAACTTCGTATAGCATACATTATACGAAGTTAT LOXP
Site specific recombination- re-using antibiotic resistance drugr Cre recombinase synapsis excision
Site specific recombination Courtesy of the National Library of Medicine (NLM)
Understanding recombination is the key to manipulating the DT40 genome
Words of warning 3 copies of chromosome 2 Genomes are ‘plastic’- Don’t culture for too long