1 / 37
Download Presentation

DNA Computing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Computing Presented By:- Anil Kumar MNW-882-2K11

  2. Presentation Outline Basic concepts of DNA What is DNA Computer Basic operations in DNA Origin of DNA Computing Advantages of DNA Computing Disadvantages of DNA Computing Conclusion

  3. What is DNA? All organisms on this planet are made of the same type of genetic blueprint. Within the cells of any organism is a substance called DNA which is a double-stranded helix of nucleotides. DNA carries the genetic information of a cell. This information is the code used within cells to form proteins and is the building block upon which life is formed. Strands of DNA are long polymers of millions of linked nucleotides.

  4. Graphical Representation of inherent bonding properties of DNA

  5. Double Helix shape of DNA

  6. What is a DNA Computer? • A DNA computer, as the name implies, uses DNA strands to store information and use the recombinative properties of DNA to perform operations. • A small test tube of DNA strands suspended in a solution could yield millions to billions of simultaneous interactions at speeds. • Parallel processing rather than linear processing.

  7. Principles of DNA Computing • With a DNA computer, a sequence of its four basic nucleotides — adenine, cytosine, guanine, and thymine is used to represent and store data on a strand of DNA. • Instead of using electrical impulses to represent bits of information, the DNA computer uses the chemical properties of these molecules by examining the patterns of combination or growth of the molecules or strings. • DNA can do this through the use of enzymes, which are biological catalysts that could be called the ’software’, used to execute the desired calculation.

  8. Basic operations on DNA

  9. Basic operations on DNA

  10. Basic operations on DNA

  11. Basic operations on DNA

  12. Basic operations on DNA

  13. Basic operations on DNA

  14. Basic operations on DNA

  15. Basic operations on DNA • Ligating: paste DNA strands with compatible sticky ends by using DNA ligase. • Marking single strands by hybridization: complementary sequences are attached to the strands, making them double-stranded. • Unmarkingof the double-strands by denaturing, that is, by detaching the complementary strands. The marked sequences will be double stranded while the unmarked ones will be single-stranded.

  16. Origin of DNA Computing Firstly Leonard Adleman proposed that the makeup of DNA and its features of combining nucleotides could have application in computational research techniques.

  17. Travelling Salesman Problem Adleman came to know that DNA has potential to solve complex mathematical problems Adleman solved TSP problem to find the route between Los Angeles And New York using DNA Computing.

  18. Travelling Salesman Problem He carried out the experiment in following manner Strands of DNA represent the seven cities. In genes, genetic coding is represented by the letters A, T, C and G. Some sequence of these four letters represented each city and possible flight path. These molecules are then mixed in a test tube, with some of these DNA strands sticking together. A chain of these strands represents a possible answer.

  19. Travelling Salesman Problem Within a few seconds, all of the possible combinations of DNA strands, which represent answers, are created in the test tube. Adleman eliminates the wrong molecules through chemical reactions, which leaves behind only the flight paths that connect all seven cities.

  20. Travelling Salesman Problem Specifically, the method based on Adleman’s experiment would be as follows: Generate all possible routes. 2. Select route that start with the proper city and end with the final city. 3. Select routes with the correct number of cities. 4. Select routes that contain each city only once.

  21. Travelling Salesman Problem Generate all possible routes:- Encode city names in short DNA sequences as shown below Each city can be represented by a "word" of six bases:

  22. Travelling Salesman Problem Generate all possible routes:- The entire root can be encoded by simply stringing together these DNA sequences that represent specific cities. For example The route from L.A -> Chicago -> Dallas -> Miami -> New York would simply be the sequence GCTACGCTAGTATCGTACCTACGGATGCCG

  23. Travelling Salesman Problem Generate all possible routes:- Now how could we genrate such routes? Route between Miami (CTACGG) and NY (ATGCCG) can be made by taking the second half of the coding for Miami (CGG) and the first half of the coding for NY (ATG). This gives CGGATG. By taking the complement of this you get, GCCTAC, which not only uniquely represents the route from Miami to NY, but will connect the DNA representing Miami and NY by hybridizing itself to the second half of the code representing Miami (...CGG) and the first half of the code representing NY (ATG...).

  24. Travelling Salesman Problem Generate all possible routes:- Random routes can be made by mixing city encodings with the route encodings. Finally, the DNA strands can be connected together by an enzyme called ligase.

  25. Travelling Salesman Problem Generate all possible routes:- We are left with strands of DNA representing itineraries with a random number of cities and random set of routes. For example:

  26. Travelling Salesman Problem Select routes that start and end with the correct cities;- Selectively copy and amplify only the section of the DNA that starts with LA and ends with NY by using the Polymerase Chain Reaction. Polymerase will copy a section of single stranded DNA starting at the position of a primer, a short piece of DNA complimentary to one end of a section of the DNA that you're interested in.

  27. Travelling Salesman Problem Select routes that start and end with the correct cities;- So to selectively amplify the itineraries that start and stop with our cities of interest, we use primers that are complimentary to LA and NY. What we end up with after PCR is a test tube full of double stranded DNA of various lengths, encoding itineraries that start with LA and end with NY.

  28. Travelling Salesman Problem Select routes that contain the correct number of cities:- Sort the DNA by length and select the DNA whose length corresponds to 5 cities. To accomplish this we will use a technique called Gel Electrophoresis

  29. Travelling Salesman Problem Select routes that contain the correct number of cities:- The basic principle behind Gel Electrophoresis is to force DNA through a gel matrix by using an electric field. DNA is a negatively charged molecule under most conditions, so if placed in an electric field it will be attracted to the positive potential. The gel matrix in which DNA is placed is made up of a polymer that forms a meshwork of linked strands. The DNA now is forced to thread its way through tiny spaces between these strands, which slows down the DNA at different rates depending on its length.

  30. Travelling Salesman Problem Select routes that contain the correct number of cities:- Now we typically end up with after running a gel is a series of DNA bands, with each band corresponding to a certain length. We can then simply cut out the band that was 30 base pairs long.

  31. Travelling Salesman Problem Select routes that have a complete set of cities:- We will do this by affinity purification technique. It successively filters the DNA molecules by city, one city at a time.

  32. Problems with Adleman’s Experiment The researchers performed Adleman’s Experiment and the results obtained were inconclusive. The researchers state that “At this time we have carried out every step of Adleman’s Experiment but have not gotten an unambiguous final result.” The problem is because of the underlying assumption that the biological operations are error-free.

  33. Advantages of DNA Computing Perform millions of operations simultaneously (Parallel Computing). Capable of storing billions of times more data Minimal storage requirements. Minimal power requirements. They are inexpensive to build, being made of common biological materials. DNA computers smaller than any computer

  34. Disadvantages of DNA Computing Generating solution sets, even for some relatively simple problems, may require impractically large amounts of memory (lots and lots of DNA strands are required). DNA computers could not (at this point) replace traditional computers. They are not programmable and the common human being can not sit down at a familiar keyboard and get to work. It requires human assistance.

  35. Conclusion DNA computers can't be found at your local electronics store yet. The technology is still in development. Bio molecular computers, made of DNA and other biological molecules, only exist today in a few specialized labs. The current applications of DNA chips are restricted to the field of medicine. The first DNA computers are unlikely to feature word processing, e-mailing and solitaire programs. If developed, their powerful computing power will be used by national governments for cracking secret codes, or by airlines wanting to map more efficient routes.

  36. References • http://www.howstuffworks.com/ Structure of DNA • http://www.rsa.com/ What is DNA computing? • http://www.features.techworld.com/ Computational nanotechnology / Nanobiotechnology • http://www.networkworld.com/ Are DNA Computer Chips a Reality? • http://www.ezinearticles.com/ Latest Paper presentation on DNA computing • http://www.nature.com/ Nature Nanotechnology /Nanocomputing/ • http://www.latestinfo.com/ Dna-computing.html

  37. THANK YOU!!!!

More Related