140 likes | 397 Views
Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China. BACKGROUND.
E N D
Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China
BACKGROUND Papillary thyroid carcinoma (PTC) is the most prevalent form accounting for 80% of all thyroid carcinoma. PTC is frequently associated with RET/PTC1 rearrangement and BRAFV600E(T1799A) mutation, especially in the sporadic patients.
OBJECTIVE To observe and compare the different tumorigenesis of the orthotopic and hypodermic models of PTC cell lines in nude mice.
METHODS The following human PTC cell lines were used: TPC-1, B5-16 and B2-7. TPC-1 and B2-7---- RET/PTC1 rearrangement B5-16 ----BRAFV600E mutation
The Orthotopic and hypodermic nude mice models of thyroid cancer. Experimental animal: 8-week-old female nude mice. Anesthesia: intraperitoneal injection of chloralic hydras. Surgery: A 1-cm-long midline incision was made, then the underlying submandibular glands and the strap muscles were bluntly dissected. The thyroid was clearly exposed. Orthotopic and hypodermic injection: 2*105 cells in D-Hanks was injected into the left thyroid gland and under back skin of nude mice, respectively. • Observation time: At 4 and 12 weeks. • Observation data: The weight of orthotopic thyroid tumor and hypodermic tumor. Serum FT3,FT4 were detected using chemiluminescent immunoassay.
RESULTS Marker TPC-1 B2-7 B5-16 B5-16:BRAFV600E(T1799A mutation) GGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAG TPC-1: GGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAG B2-7: GGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAG Marker TPC-1 B2-7 B5-16 GAPDH RET/PTC1
The tumorigenesis of the orthotopic and hypodermic models of PTC cell lines in nude mice was remarkable dissimilarity. • TPC-1 and B5-16 were 100% tumorigenic in the orthotopic and hypodermic mice models (n=10). • However, B2-7 was only 10% tumorigenic in the orthotopic model, and it was negative in the hypodermic model (n=10).
The development of the orthotopic and hypodermic tumor in TPC-1 and B5-16 models for 4 weeks. mg TPC-1 B5-16
The development of the orthotopic and hypodermic tumor in TPC-1 and B5-16 models for 12 weeks. mg TPC-1 B5-16
The level of thyroid hormone reflects the destroy of thyroid function in the orthotopic models. ** * * 4 weeks 12 weeks
The morphological changes of the orthotopic thyroid tumor (HE staining) TPC-1 B5-16 Control
CONCLUSION The growth of PTC cell lines needs different internal environment. The tumorigenesis of the orthotopic and hypodermic models of three PTC cell lines in nude mice was different. The hypodermic or orthotopic PTC models should be chosen according to the study objective. The hypodermic model---Its operation and observation is easy and convenient. The orthotopic model ---Its phenotype is close to the primary PTC.
ACKNOWLEDGE Professor LS.Teng and Dr WB.Wang, The First Affiliated Hospital, College of Medicine, Zhejiang University. My teacher professor ZP.Chen ,YQ.Yan and my workmate. Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China