ata
Uploaded by
13 SLIDES
405 VIEWS
140LIKES

Population Genetics

DESCRIPTION

Population Genetics. Do Now: Tongue rolling (T) is dominant to not being able to roll (t). In a group of 20 people, 18 can roll their tongues, and 2 cannot. What % of people have the tongue rolling phenotype?

1 / 13

Download Presentation

Population Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Population Genetics Do Now: Tongue rolling (T) is dominant to not being able to roll (t). In a group of 20 people, 18 can roll their tongues, and 2 cannot. What % of people have the tongue rolling phenotype? What is the minimum % of all of the alleles in the population that are recessive (t)?

  2. Phenotype Frequency • Phenotype frequency is the % of individuals in a population (group of organisms of the same species) that have a certain phenotype. • 18/20 = 90%

  3. Gene Pool • A gene pool is the complete set of all alleles found in all individuals in a population OO Oo Oo Gene Pool: 6 O 4 o oo OO

  4. Allele Frequency • Allele frequency is a measurement of how common an allele is in a population. • P is typically used to represent the frequency of the dominant allele, and Q represents the recessive • PA = f(AA) + ½ f(Aa) • Qa = f(aa) + ½ f(Aa) • By definition, P + Q = 1

  5. Allele Frequency Example • In a population of 100 humans, 90 are homozygous dominant for albinism (non-albino) • 8 are heterozygous • 2 are homozygous recessive • P = f(AA) + ½ f(Aa) = .90 + ½ (.08) = .94 • Q = f(aa) + ½ f(Aa) = .02 + ½ (.08) = .06 • Check • P + Q = 1… .94 + .06 = 1

  6. Genome • A genome is all of the genetic information of an individual. • A genome includes both genes AND non-gene information (“junk” DNA) • The human genome is 3.2 billion bases long. • ATGCTTATGCTGGCTAGCTGCGCTATCGAT…

  7. “Everything is everywhere, the environment selects.”

  8. Genome Wars • We will be playing a game to simulate the effect of the environment on a population

  9. You are a Prokaryote • Locked in a desperate struggle for survival…

  10. Part 1: Make a genome • You will select 4 alleles to make up your genome. Each allele gives you a bonus in a specific environment…

  11. Part 2: Determine Allele Frequencies • What does the gene pool look like?

  12. Part 3: Evolve! • Extinctions, mutations, and environmental change… can your genome make it?

  13. Review • What’s a genome? • Allele frequency? • Gene pool? • And what does the selecting in biology?

More Related