arva
Uploaded by
23 SLIDES
425 VIEWS
230LIKES

Quiz Revision

DESCRIPTION

Quiz Revision. What is the accession number for the corresponding protein sequence ? NP_001073591.1. 2. Given that the molecular mass of 1 amino acid ≈ 110 Da , calculate the molecular mass of the following regions of the protein:. sig_peptide 364..429

1 / 23

Download Presentation

Quiz Revision

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Quiz Revision

  2. What is the accession number for the corresponding protein sequence? NP_001073591.1

  3. 2. Given that the molecular mass of 1 amino acid ≈ 110 Da, calculate the molecular mass of the following regions of the protein:

  4. sig_peptide 364..429 /gene="PRNP” proprotein 430..1122 /gene="PRNP" /product="prion protein proprotein“ mat_peptide 430..1053 /gene="PRNP" /product="prion protein" 1 aa ≈ 110 Da (429-364+1)/3= 22aa (22*110)/1000 = 2.420 (231*110)/1000 = 25.410 (1122-430+1)/3= 231aa (1053-430+1)/3= 208aa (208*110)/1000 = 22.880 (0.5 mark for each correct field)

  5. 3’ 5’ 5’ 3’ 5’UTR Exon 2 3’UTR Exon 1 DNA Intron transcription Transcription start 5’ 3’ RNA splicing 5’ mRNA/cDNA AAAAAAA….3’ AUG UGA Met……………………*stop PrePro“Peptide” Met……………………*stop Pro“Peptide” Signal peptide Pro Peptide Mature Peptide Mature Peptide

  6. 3. Copy and paste below the signal peptide sequence and the corresponding nucleotide sequence. sig_peptide 364..429 /gene="PRNP” Length = 22aa (From Q9)

  7. /translation="MANLGCWMLVLFVATWSDLGLCKKRPKPGGWNTGGSRYPGQGSPGGNRYPPQGGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQGGGTHSQWNKPSKPKTNMKHMAGAAAAGAVVGGLGGYMLGSAMSRPIIHFGSDYEDRYYRENMHRYPNQVYYRPMDEYSNQNNFVHDCVNITIKQHTVTTTTKGENFTETDVKMMERVVEQMCITQYERESQAYYQRGSSMVLFSSPPVILLISFLIFLIVG" /translation="MANLGCWMLVLFVATWSDLGLCKKRPKPGGWNTGGSRYPGQGSPGGNRYPPQGGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQGGGTHSQWNKPSKPKTNMKHMAGAAAAGAVVGGLGGYMLGSAMSRPIIHFGSDYEDRYYRENMHRYPNQVYYRPMDEYSNQNNFVHDCVNITIKQHTVTTTTKGENFTETDVKMMERVVEQMCITQYERESQAYYQRGSSMVLFSSPPVILLISFLIFLIVG" 301 tccgagccag tcgctgacag ccgcggcgcc gcgagcttct cctctcctca cgaccgagt 361 attatggcgaaccttggctg ctggatgctg gttctctttg tggccacatg gagtgacctg 421 ggcctctgca agaagcgccc gaagcctgga ggatggaaca ctgggggcag ccgatacccg 481 gggcagggca gccctggagg caaccgctac ccacctcagg gcggtggtgg ctgggggcag

  8. 4. The signal peptide is cleaved off after the preproprotein is synthesized and the proprotein is then translocated to the appropriate cellular compartment. The proprotein is further cleaved at the C-terminus to yield the mature peptide. • For each of the following, annotate their regions in the diagram below according to the annotations provided in the record. • signal peptide • proprotein • mature protein • fragment cleaved off at the C-terminus • stop codon

  9. Preproprotein Proprotein N’ C’ Signal peptide Mature peptide C terminus Cleavage (frequently N terminus) sig_peptide 364..429 /gene="PRNP” proprotein 430..1122 /gene="PRNP" /product="prion protein proprotein“ mat_peptide 430..1053 /gene="PRNP" /product="prion protein"

  10. Preproprotein Proprotein N’ C’ Mature peptide Signal peptide sig_peptide 364..429 /gene="PRNP” proprotein 430..1122 /gene="PRNP" /product="prion protein proprotein“ mat_peptide 460..1122 /gene="PRNP" /product="prion protein“ Fragment from 430 to 460 “lost” (N terminus cleavage)

  11. 5. What is the length of the C-terminus fragment that is cleaved off?

  12. CDS 364..1125 /gene="PRNP" /note="prion-related protein; major prion protein; CD230 antigen; prion protein PrP; p27-30" /codon_start=1 /product="prion protein preproprotein" /protein_id="NP_001073591.1" /db_xref="GI:122056625" /db_xref="CCDS:CCDS13080.1“ Fragment cleaved off: 1054… 1125 Length cleaved off= (1125-1054+1)/3 = 24 aa NOTE: Coding region (CDS) is inclusive of stop codon!

  13. 361 attatggcga accttggctg ctggatgctg gttctctttg tggccacatg gagtgacctg 421 ggcctctgca agaagcgccc gaagcctgga ggatggaaca ctgggggcag ccgatacccg 481 gggcagggca gccctggagg caaccgctac ccacctcagg gcggtggtgg ctgggggcag 541 cctcatggtg gtggctgggg gcagcctcat ggtggtggct gggggcagcc ccatggtggt 601 ggctggggac agcctcatgg tggtggctgg ggtcaaggag gtggcaccca cagtcagtgg 661 aacaagccga gtaagccaaa aaccaacatg aagcacatgg ctggtgctgc agcagctggg 721 gcagtggtgg ggggccttgg cggctacatg ctgggaagtg ccatgagcag gcccatcata 781 catttcggca gtgactatga ggaccgttac tatcgtgaaa acatgcaccg ttaccccaac 841 caagtgtact acaggcccat ggatgagtac agcaaccaga acaactttgt gcacgactgc 901 gtcaatatca caatcaagca gcacacggtc accacaacca ccaaggggga gaacttcacc 961 gagaccgacg ttaagatgat ggagcgcgtg gttgagcaga tgtgtatcac ccagtacgag 1021 agggaatctc aggcctatta ccagagagga tcgagcatggtcctcttctc ctctccacct 1081 gtgatcctcc tgatctcttt cctcatcttc ctgatagtgggatgaggaag gtcttcctgt Stop Codon This is the DNA sequence. Neither the Corresponding RNA sequence nor the DNA sequence is cleaved. It is the polypeptide Chain that is cleaved.

  14. CDS 364..1125 /gene="PRNP" /note="prion-related protein; major prion protein; CD230 antigen; prion protein PrP; p27-30" /codon_start=1 /product="prion protein preproprotein" /protein_id="NP_001073591.1" /db_xref="GI:122056625" /db_xref="CCDS:CCDS13080.1“ /translation="MANLGCWMLVLFVATWSDLGLCKKRPKPGGWNTGGSRYPGQGSPGGNRYPPQGGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQGGGTHSQWNKPSKPKTNMKHMAGAAAAGAVVGGLGGYMLGSAMSRPIIHFGSDYEDRYYRENMHRYPNQVYYRPMDEYSNQNNFVHDCVNITIKQHTVTTTTKGENFTETDVKMMERVVEQMCITQYERESQAYYQRGSSMVLFSSPPVILLISFLIFLIVG" Peptide sequence removed during post-translational processing

  15. 6. Write down the poly-adenylation signal (poly-A signal) sequence that marks out the signal for polyadenylation to the nascent mRNA. polyA_signal 2707..2712 /gene="PRNP" 2701 actgaaattaaacgagcgaa gatgagcacc aaaaaaaaaa aaaaaa Ans: AUUAAA

  16. 7. How many introns interrupt this coding sequence and mark the position where the intron is located and annotate it on the margin? Why is it not possible for you to write down the intron sequence based on this database record?

  17. exon 1..358 /gene="PRNP" /inference="alignment:Splign" /number=1a STS 356..1135 /gene="PRNP" /standard_name="PMC136957P1" /db_xref="UniSTS:270809" exon 359..2731 /gene="PRNP" /inference="alignment:Splign" /number=2b 1 358 359 2731 Exon 1 Intron Exon 2

  18. 3’ 5’ 5’ 3’ 5’UTR Exon 2 3’UTR Exon 1 DNA Intron transcription Transcription start 5’ 3’ RNA splicing 5’ AAAAAAA….3’ mRNA/cDNA AUG UGA Intron already spliced out from the mRNA after which the cDNA is made during the sequencing process

  19. 8. Why is it not possible for you to write down the intron sequence based on this database record? The database record shows the cDNA sequence of the mature mRNA, which consists only of exons; introns are spliced out of the pre-mRNA to form the mature mRNA

  20. 9. For RNA Polymerase to produce the mRNA corresponding to this sequence as given (the sense strand), it has to read the reverse complement antisense DNA strand or the template strand and make use of base-pairing to synthesize the corresponsing sense strand mRNA. Based on this sequence, write down the last 10 nucleotide bases of the DNA sequence which the RNA polymerase reads in order to generate the prion mRNA. Write the DNA sequence from 5’ to 3’ (as per standard convention).

  21. polyA_site 2731 /gene="PRNP" 2581 atccaaagtg gacaccatta acaggtcttt gaaatatgca tgtactttat attttctata 2641 tttgtaactt tgcatgttct tgttttgtta tataaaaaaa ttgtaaatgt ttaatatctg 2701 actgaaatta aacgagcgaa gatgagcacc aaaaaaaaaa aaaaaa RNA 5’-GAUGAGCACC-3’ transcription DNA 3’-CTACTCGTGG- 5’ Reverse Ans: 5’-GGTGCTCATC-3’

  22. 10. If the sequence of the nucleic acid of this database record is that of an mRNA strand, why is it recorded here in ATCGs and not AUCGs? • By convention, only corresponding DNA is shown in the database, even if it is a transfer RNA or rRNA. Hence, because the sequence in the database record is a cDNA, which is synthesised from an mRNA template using the reverse transcriptase enzyme, you don’t see the base U for DNA. • DNA is easier to handle than mRNA for sequencing or experimental analysis because it is more stable. RNA is prone to hydrolysis because of the presence of 2’ –OH group which attacks the phosphorus atom.

  23. cDNA stored in the database • It is the cDNA which directly corresponds to the mRNA that is stored in the nucleotide database How can we be sure? a auaaa

More Related