arn k sako n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
ARN késako ? PowerPoint Presentation
Download Presentation
ARN késako ?

Loading in 2 Seconds...

play fullscreen
1 / 47

ARN késako ? - PowerPoint PPT Presentation


  • 150 Views
  • Uploaded on

ARN késako ?. Julie BERNAUER Adrien GUILHOT-GAUDEFFROY Yann PONTY Mireille REGNIER. EQUIPE PROJET AMIB Inria Saclay. 28 Septembre 2012. 1. Les ARN et leur repliement. Principe central de la biologie moléculaire. G. T. C. G. A. G. T. C. A. ADN. ARN Poly. C. A. G. C.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'ARN késako ?' - arlo


Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
arn k sako

ARN késako ?

Julie BERNAUER AdrienGUILHOT-GAUDEFFROY

Yann PONTY Mireille REGNIER

EQUIPE PROJET

AMIB

InriaSaclay

28 Septembre 2012

les arn et leur repliement

1

Les ARN et leur repliement

Nuit des chercheurs - LIX/Inria AMIB

principe central de la biologie mol culaire
Principe central de la biologiemoléculaire

G

T

C

G

A

G

T

C

A

ADN

ARN Poly.

C

A

G

C

T

C

A

G

T

ARNm

G

U

C

G

A

G

U

C

A

Ribosome

Ala

Leu

Cyt

Protéine

Règle: ADN (A,C,G,T)

→ ARN (A,C,G,U)

→Protéine

Maisilexiste de trèsnombreusesexceptions, et de trèsnombreuxautresrôles pour l’ARN !

Nuit des chercheurs - LIX/Inria AMIB

repliement des arn
Repliement des ARN
  • ARN = un seul brin
  • Structure très variable …
  • … plus conservée au cours de l’évolution que la séquence
  • Diversité de fonction

Fonction (partiellement) codée dans la structure Prédire le repliement de l’ARN

Nuit des chercheurs - LIX/Inria AMIB

les paires de bases canoniques
Les paires de bases (Canoniques)

Nuit des chercheurs - LIX/Inria AMIB

la structure secondaire une simplification raisonnable
La structure secondaire : Une simplification raisonnable

Contraintes/Règles du jeu

  • Uniquement Watson/Crick (A/U et G/C) et Wobble (G/U)
  • Pseudonoeudsinterdits

G

U

G

G

G

A

G

U

A

C

G

C

Modèle 3D

ARN ribosomal (5s)

Structure secondaire

Nuit des chercheurs - LIX/Inria AMIB

repliement par m inimisation de l nergie libre
Repliement par minimisation de l’énergielibre

Séquenced’ARN

…CAGUAGCCGAUCGCAGCUAGCGUA…

Nombreuses structures secondaires

Paradigmehistorique :

Structure fonctionnelle= Structure compatible la plus stable

= Structure d’énergielibreminimale

Nombre maximal de paires de bases

Nuit des chercheurs - LIX/Inria AMIB

au boulot

2

Au boulot …

Nuit des chercheurs - LIX/Inria AMIB

a vous de jouer
A vous de jouer !

GAGAAGUACUUGAAAUUGGCCUCCUC

Saurez vous trouver, pour l’ARN ci-dessus, le repliement ayant un nombre maximal de paires de bases ?

Règles :

Seules les paires de bases canoniquessont autorisées.

Les croisementset liaisons extérieuressont interdites.

U

A

C

U

G

G

A

U

G

G

C

U

Nuit des chercheurs - LIX/Inria AMIB

solution
Solution

Cerepliementestle seul à appariertoutes les bases.

Il existait8 553 597repliements(partiels) valides.

Comment retrouvercerepliement sans les énumérertous ?

 Algorithme de programmationdynamique

(Diviser pour régner + Mémorisation des résultats)

Nuit des chercheurs - LIX/Inria AMIB

le design d arn

3

Le design d’ARN

Un problème inverse

Nuit des chercheurs - LIX/Inria AMIB

design d arn structur s
Design d’ARNstructurés
  • On sait (à peuprès) prédire le repliement des ARN
  • Pourrait on s’enservir pour créerde nouvellesmolécules ?

Design d’ARN : Créeruneséquence se repliant en unestructure secondaireprédéterminée (ex. : rôlethérapeutique).

Prédiction du repliement

…CAGUAGCCGAUCGCAGCUAGCGUA…

Design d’ARN

Nuit des chercheurs - LIX/Inria AMIB

a vous de jouer1
A vous de jouer…

Aucunalgorithme exact et efficacen’estactuellementconnu.

Saurezvousrésoudre le problèmeà la main ?

But du jeu : Créeruneséquence ARN

  • se repliantoptimalementen la structure cible #maximal de paires de bases = #pairesdans structure cible.
  • de façonunique pas de repliementalternatifayantautant de paires de bases.

Nuit des chercheurs - LIX/Inria AMIB

a vous de jouer2
A vous de jouer…

Positions correctes

Nombre de repliements co-optimaux

(7 paires de base)

Navigation parmisles co-optimaux

Séquence courante

Repliementvisé

Nuit des chercheurs - LIX/Inria AMIB

a vous de jouer3
A vous de jouer…

La séquence est modifiée en cliquant sur une position

Nuit des chercheurs - LIX/Inria AMIB

a vous de jouer4
A vous de jouer…

La séquence est modifiée en cliquant sur une position

Le repliement de la nouvelle séquence est calculé et affiché

Le nombre de repliements co-optimaux est mis à jour

Nuit des chercheurs - LIX/Inria AMIB

a vous de jouer5
A vous de jouer…

La séquence est modifiée en cliquant sur une position

La partie se termine quand le repliement est correct et unique.

Le repliement de la nouvelle séquence est calculé et affiché

Le nombre de repliements co-optimaux est mis à jour

Nuit des chercheurs - LIX/Inria AMIB

merci questions
Merci !Questions ?
    • AMIB Saclay
  • www.inria.fr
algorithmique du repliement

Algorithmique du repliement

Nuit des chercheurs - LIX/Inria AMIB

slide21

?

Quelcaschoisir ???

Nuit des chercheurs - LIX/Inria AMIB

slide22

?

?

?

Quelcaschoisir ???

Nuit des chercheurs - LIX/Inria AMIB

slide23

20

19

17

2

16

0

20

<22

18

22

20

Quelcaschoisir ???

Nuit des chercheurs - LIX/Inria AMIB

slide24

Quelcaschoisir ???Fautiltout essayer ?

Nuit des chercheurs - LIX/Inria AMIB

slide25

Quelcaschoisir ???Fautiltout essayer ?

Nuit des chercheurs - LIX/Inria AMIB

slide26

Migraine

Nombreexponentiel de solutions→ Impossible de tout essayer !!

Quelcaschoisir ???Fautil tout essayer ?

Nuit des chercheurs - LIX/Inria AMIB

slide27

Migraine

Nombreexponentiel de solutions→ Impossible de tout essayer !!

Quelcaschoisir ???Fautil tout essayer ?

Nuit des chercheurs - LIX/Inria AMIB

slide28

#Atomesdansl’univers (1080)

Migraine

Nombreexponentiel de solutions→ Impossible de tout essayer !!

Quelcaschoisir ???Fautil tout essayer ?

Nuit des chercheurs - LIX/Inria AMIB

slide29

Maiscalculredondant …

Nuit des chercheurs - LIX/Inria AMIB

slide30

Maiscalculredondant …

Nuit des chercheurs - LIX/Inria AMIB

slide31

Solution : Diviser pour régner(Déléguer pour résoudre)

Nuit des chercheurs - LIX/Inria AMIB

slide32

20 !

?

Solution : Diviser pour régner(Déléguer pour résoudre)

Nuit des chercheurs - LIX/Inria AMIB

slide33

19 !

?

Solution : Diviser pour régner(Déléguer pour résoudre)

Nuit des chercheurs - LIX/Inria AMIB

slide34

?

18 !

0 !

?

Solution : Diviser pour régner(Déléguer pour résoudre)

Nuit des chercheurs - LIX/Inria AMIB

slide35

16 !

2 !

?

?

Solution :Diviser pour régner(Déléguer pour résoudre)

Nuit des chercheurs - LIX/Inria AMIB

slide36

19 !

?

Solution : Diviser pour régner(Déléguer pour résoudre)

Nuit des chercheurs - LIX/Inria AMIB

slide37

18 !

?

Solution : Diviser pour régner(Déléguer pour résoudre)

Nuit des chercheurs - LIX/Inria AMIB

combien a co te programmation dynamique
Combiençacoûte ? (Programmationdynamique)

= Max

Max( + + )

  • Nombre de danseurs → n
  • Un assistant par régiondans la ronde→ (n*(n-1)) / 2 ≈ n2
  • Chaque assistant fait, au pire, ncalculs
  • Nombre total de calculs :A peuprèsn3 …

!

?

?

?

?

?

Attention à l’ordre des calculs(Commencer par les petites régions …)

Nuit des chercheurs - LIX/Inria AMIB

combien a co te
Combiençacoûte

Migraine

= Max

Max( + + )

  • Nombre de danseurs → n
  • Un assistant par régiondans la ronde→ (n*(n-1)) / 2 ≈ n2
  • Chaque assistant fait, au pire, n+1calculs
  • Nombre total de calculs :A peuprèsn3 …

!

?

?

?

?

?

Attention à l’ordre des calculs(Commencer par les petites régions …)

Nuit des chercheurs - LIX/Inria AMIB

combien a co te1
Combiençacoûte

Migraine

= Max

Max( + + )

40

40

  • Nombre de danseurs → n
  • Un assistant par régiondans la ronde→ (n*(n-1)) / 2 ≈ n2
  • Chaque assistant fait, au pire, n+1calculs
  • Nombre total de calculs :A peuprèsn3 …

!

?

?

?

?

?

Attention à l’ordre des calculs(Commencer par les petites régions …)

Nuit des chercheurs - LIX/Inria AMIB

quelques applications

Quelques applications

Nuit des chercheurs - LIX/Inria AMIB

performances
Performances

Nuit des chercheurs - LIX/Inria AMIB

evaluer la qualit d une pr diction
Evaluer la qualitéd’uneprédiction

Intron du groupeII (D1-D4)RFAM ID: RF02001

RNAFold[Gruber AR et al. NAR 2008]

Nuit des chercheurs - LIX/Inria AMIB

evaluer la qualit d une pr diction1
Evaluer la qualitéd’uneprédiction

Intron du groupeII (D1-D4)RFAM ID: RF02001

RNAFold[Gruber AR et al. NAR 2008]

Nuit des chercheurs - LIX/Inria AMIB

evaluer la qualit d une pr diction2
Evaluer la qualitéd’uneprédiction

Intron du groupeII (D1-D4)RFAM ID: RF02001

RNAFold[Gruber AR et al. NAR 2008]

Nuit des chercheurs - LIX/Inria AMIB

De faiblesprobabilitésindiquent des régionsincertaines

BP>99% → Avg. PPV>90%

BP>90% → PPV>83%

sensibilit des arn aux mutations
Sensibilité des ARN aux mutations

[Halvorsen M et al, PLOS Gen 2010]

Nuit des chercheurs - LIX/Inria AMIB

Echantillonage→ Clustering→ PCA

sensibilit des arn aux mutations1
Sensibilitédes ARN aux mutations

?

[Halvorsen M et al, PLOS Gen 2010]

Nuit des chercheurs - LIX/Inria AMIB

Echantillonage→ Clustering → PCA