combinatorial pattern matching l.
Skip this Video
Download Presentation
Combinatorial Pattern Matching

Loading in 2 Seconds...

play fullscreen
1 / 102

Combinatorial Pattern Matching - PowerPoint PPT Presentation

  • Uploaded on

Combinatorial Pattern Matching. Outline. Hash Tables Repeat Finding Exact Pattern Matching Keyword Trees Suffix Trees Heuristic Similarity Search Algorithms Approximate String Matching Filtration Comparing a Sequence Against a Database Algorithm behind BLAST Statistics behind BLAST

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about 'Combinatorial Pattern Matching' - andrew

Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
  • Hash Tables
  • Repeat Finding
  • Exact Pattern Matching
  • Keyword Trees
  • Suffix Trees
  • Heuristic Similarity Search Algorithms
  • Approximate String Matching
  • Filtration
  • Comparing a Sequence Against a Database
  • Algorithm behind BLAST
  • Statistics behind BLAST
  • PatternHunter and BLAT
genomic repeats
Genomic Repeats
  • Example of repeats:
  • Motivation to find them:
    • Genomic rearrangements are often associated with repeats
    • Trace evolutionary secrets
    • Many tumors are characterized by an explosion of repeats
genomic repeats4
Genomic Repeats
  • The problem is often more difficult:
  • Motivation to find them:
    • Genomic rearrangements are often associated with repeats
    • Trace evolutionary secrets
    • Many tumors are characterized by an explosion of repeats
l mer repeats
l-mer Repeats
  • Long repeats are difficult to find
  • Short repeats are easy to find (e.g., hashing)
  • Simple approach to finding long repeats:
    • Find exact repeats of short l-mers (l is usually 10 to 13)
    • Use l-mer repeats to potentially extend into longer, maximal repeats
l mer repeats cont d
l-mer Repeats (cont’d)
  • There are typically many locations where an l-mer is repeated:


  • The 4-mer TTAC starts at locations 3 and 17
extending l mer repeats
Extending l-mer Repeats


  • Extend these 4-mer matches:


  • Maximal repeat: TTACAGAT
maximal repeats
Maximal Repeats
  • To find maximal repeats in this way, we need ALL start locations of all l-mers in the genome
  • Hashing lets us find repeats quickly in this manner
hashing what is it
Hashing: What is it?
  • What does hashing do?
    • For different data, generate a unique integer
    • Store data in an array at the unique integer index generated from the data
  • Hashing is a very efficient way to store and retrieve data
hashing definitions
Hashing: Definitions
  • Hash table: array used in hashing
  • Records: data stored in a hash table
  • Keys: identifies sets of records
  • Hash function: uses a key to generate an index to insert at in hash table
  • Collision: when more than one record is mapped to the same index in the hash table
hashing example
Hashing: Example
  • Where do the animals eat?
  • Records: each animal
  • Keys: where each animal eats
hashing dna sequences
Hashing DNA sequences
  • Each l-mer can be translated into a binary string (A, T, C, G can be represented as 00, 01, 10, 11)
  • After assigning a unique integer per l-mer it is easy to get all start locations of each l-mer in a genome
hashing maximal repeats
Hashing: Maximal Repeats
  • To find repeats in a genome:
    • For all l-mers in the genome, note the start position and the sequence
    • Generate a hash table index for each unique l-mer sequence
    • In each index of the hash table, store all genome start locations of the l-mer which generated that index
    • Extend l-mer repeats to maximal repeats
hashing collisions
Hashing: Collisions
  • Dealing with collisions:
    • “Chain” all start locations of l-mers (linked list)
hashing summary
Hashing: Summary
  • When finding genomic repeats from l-mers:
    • Generate a hash table index for each l-mer sequence
    • In each index, store all genome start locations of the l-mer which generated that index
    • Extend l-mer repeats to maximal repeats
pattern matching
Pattern Matching
  • What if, instead of finding repeats in a genome, we want to find all sequences in a database that contain a given pattern?
  • This leads us to a different problem, the Pattern MatchingProblem
pattern matching problem
Pattern Matching Problem
  • Goal: Find all occurrences of a pattern in a text
  • Input: Pattern p = p1…pn and text t = t1…tm
  • Output: All positions 1<i< (m – n + 1) such that the n-letter substring of t starting at i matches p
  • Motivation: Searching database for a known pattern
exact pattern matching a brute force algorithm
Exact Pattern Matching: A Brute-Force Algorithm


  • n length of pattern p
  • m length of text t
  • for i  1 to (m – n + 1)
  • if ti…ti+n-1 = p
  • outputi
exact pattern matching an example
Exact Pattern Matching: An Example


  • PatternMatching algorithm for:
    • Pattern GCAT
    • Text CGCATC










exact pattern matching running time
Exact Pattern Matching: Running Time
  • PatternMatching runtime: O(nm)
  • Probability-wise, it’s more like O(m)
    • Rarely will there be close to n comparisons in line 4
  • Better solution: suffix trees
    • Can solve problem in O(m) time
    • Conceptually related to keyword trees
keyword trees example
Keyword Trees: Example
  • Keyword tree:
    • Apple
keyword trees example cont d
Keyword Trees: Example (cont’d)
  • Keyword tree:
    • Apple
    • Apropos
keyword trees example cont d23
Keyword Trees: Example (cont’d)
  • Keyword tree:
    • Apple
    • Apropos
    • Banana
keyword trees example cont d24
Keyword Trees: Example (cont’d)
  • Keyword tree:
    • Apple
    • Apropos
    • Banana
    • Bandana
keyword trees example cont d25
Keyword Trees: Example (cont’d)
  • Keyword tree:
    • Apple
    • Apropos
    • Banana
    • Bandana
    • Orange
keyword trees properties
Keyword Trees: Properties
  • Stores a set of keywords in a rooted labeled tree
  • Each edge labeled with a letter from an alphabet
  • Any two edges coming out of the same vertex have distinct labels
  • Every keyword stored can be spelled on a path from root to some leaf
keyword trees threading cont d
Keyword Trees: Threading (cont’d)
  • Thread “appeal”
    • appeal
keyword trees threading cont d28
Keyword Trees: Threading (cont’d)
  • Thread “appeal”
    • appeal
keyword trees threading cont d29
Keyword Trees: Threading (cont’d)
  • Thread “appeal”
    • appeal
keyword trees threading cont d30
Keyword Trees: Threading (cont’d)
  • Thread “appeal”
    • appeal
multiple pattern matching problem
Multiple Pattern Matching Problem
  • Goal: Given a set of patterns and a text, find all occurrences of any of patterns in text
  • Input: k patterns p1,…,pk, and text t = t1…tm
  • Output: Positions 1 <i <m where substring of t starting at i matches pj for 1 <j<k
  • Motivation: Searching database for known multiple patterns
multiple pattern matching straightforward approach
Multiple Pattern Matching: Straightforward Approach
  • Can solve as k “Pattern Matching Problems”
    • Runtime:


using the PatternMatching algorithm k times

    • m - length of the text
    • n - average length of the pattern
multiple pattern matching keyword tree approach
Multiple Pattern Matching: Keyword Tree Approach
  • Or, we could use keyword trees:
    • Build keyword tree in O(N) time; N is total length of all patterns
    • With naive threading: O(N + nm)
    • Aho-Corasick algorithm: O(N + m)
keyword trees threading
Keyword Trees: Threading
  • To match patterns in a text using a keyword tree:
    • Build keyword tree of patterns
    • “Thread” the text through the keyword tree
keyword trees threading cont d40
Keyword Trees: Threading (cont’d)
  • Threading is “complete” when we reach a leaf in the keyword tree
  • When threading is “complete,” we’ve found a pattern in the text
suffix trees collapsed keyword trees
Suffix Trees=Collapsed Keyword Trees
  • Similar to keyword trees, except edges that form paths are collapsed
    • Each edge is labeled with a substring of a text
    • All internal edges have at least two outgoing edges
    • Leaves labeled by the index of the pattern.
suffix tree of a text
Suffix Tree of a Text
  • Suffix trees of a text is constructed for all its suffixes


Keyword Tree

Suffix Tree

suffix tree of a text43
Suffix Tree of a Text
  • Suffix trees of a text is constructed for all its suffixes


Keyword Tree

Suffix Tree

How much time does it take?

suffix tree of a text44
Suffix Tree of a Text
  • Suffix trees of a text is constructed for all its suffixes


Keyword Tree

Suffix Tree


Time is linear in the total size of all suffixes, i.e., it is quadratic in the length of the text

suffix trees advantages
Suffix Trees: Advantages
  • Suffix trees of a text is constructed for all its suffixes
  • Suffix trees build faster than keyword trees


Keyword Tree

Suffix Tree


linear (Weiner suffix tree algorithm)

use of suffix trees
Use of Suffix Trees
  • Suffix trees hold all suffixes of a text
    • i.e., ATCGC: ATCGC, TCGC, CGC, GC, C
    • Builds in O(m) time for text of length m
  • To find any pattern of length n in a text:
    • Build suffix tree for text
    • Thread the pattern through the suffix tree
    • Can find pattern in text in O(n) time!
  • O(n + m) time for “Pattern Matching Problem”
    • Build suffix tree and lookup pattern
pattern matching with suffix trees
Pattern Matching with Suffix Trees


  • Build suffix tree for text t
  • Thread pattern p through suffix tree
  • if threading is complete
  • output positions of all p-matching leaves in the tree
  • else
  • output “Pattern does not appear in text”
multiple pattern matching summary
Multiple Pattern Matching: Summary
  • Keyword and suffix trees are used to find patterns in a text
  • Keyword trees:
    • Build keyword tree of patterns, and thread text through it
  • Suffix trees:
    • Build suffix tree of text, and thread patterns through it
approximate vs exact pattern matching
Approximate vs. Exact Pattern Matching
  • So far all we’ve seen exact pattern matching algorithms
  • Usually, because of mutations, it makes much more biological sense to find approximate pattern matches
  • Biologists often use fast heuristic approaches (rather than local alignment) to find approximate matches
heuristic similarity searches
Heuristic Similarity Searches
  • Genomes are huge: Smith-Waterman quadratic alignment algorithms are too slow
  • Alignment of two sequences usually has short identical or highly similar fragments
  • Many heuristic methods (i.e., FASTA) are based on the same idea of filtration
    • Find short exact matches, and use them as seeds for potential match extension
    • “Filter” out positions with no extendable matches
dot matrices
Dot Matrices
  • Dot matrices show similarities between two sequences
  • FASTA makes an implicit dot matrix from short exact matches, and tries to find long diagonals (allowing for some mismatches)
dot matrices cont d
Dot Matrices (cont’d)
  • Identify diagonals above a threshold length
  • Diagonals in the dot matrix indicate exact substring matching
diagonals in dot matrices
Diagonals in Dot Matrices
  • Extend diagonals and try to link them together, allowing for minimal mismatches/indels
  • Linking diagonals reveals approximate matches over longer substrings
approximate pattern matching problem
Approximate Pattern Matching Problem
  • Goal: Find all approximate occurrences of a pattern in a text
  • Input: A pattern p = p1…pn, text t = t1…tm, and k, the maximum number of mismatches
  • Output: All positions 1 <i< (m – n +1) such that ti…ti+n-1 and p1…pn have at most k mismatches (i.e., Hamming distance between ti…ti+n-1 and p <k)
approximate pattern matching a brute force algorithm
Approximate Pattern Matching: A Brute-Force Algorithm

ApproximatePatternMatching(p, t, k)

  • n length of pattern p
  • m  length of text t
  • fori  1 to m – n + 1
  • dist  0
  • forj  1 to n
  • ifti+j-1 != pj
  • dist dist + 1
  • ifdist<k
  • outputi
approximate pattern matching running time
Approximate Pattern Matching: Running Time
  • That algorithm runs in O(nm).
  • Landau-Vishkin algorithm: O(kn)
  • We can generalize the “Approximate Pattern Matching Problem” into a “Query Matching Problem”:
    • We want to match substrings in a query to substrings in a text with at most k mismatches
    • Motivation: we want to see similarities to some gene, but we may not know which parts of the gene to look for
query matching problem
Query Matching Problem
  • Goal: Find all substrings of the query that approximately match the text
  • Input: Query q = q1…qw,

text t = t1…tm,

n (length of matching substrings),

k (maximum number of mismatches)

  • Output: All pairs of positions (i, j) such that the

n-letter substring of q starting at iapproximately matches the

n-letter substring of t starting at j,

with at most k mismatches

query matching main idea
Query Matching: Main Idea
  • Approximately matching strings share some perfectly matching substrings.
  • Instead of searching for approximately matching strings (difficult) search for perfectly matching substrings (easy).
filtration in query matching
Filtration in Query Matching
  • We want all n-matches between a query and a text with up to k mismatches
  • “Filter” out positions we know do not match between text and query
  • Potential match detection: find all matches of l-tuples in query and text for some small l
  • Potential match verification: Verify each potential match by extending it to the left and right, until (k + 1) mismatches are found
filtration match detection
Filtration: Match Detection
  • If x1…xn and y1…yn match with at most k mismatches, they must share an l-tuple that is perfectly matched, with l = n/(k + 1)
  • Break string of length n into k+1 parts, each each of length n/(k + 1)
    • k mismatches can affect at most k of these k+1 parts
    • At least one of these k+1 parts is perfectly matched
filtration match detection cont d
Filtration: Match Detection(cont’d)
  • Suppose k = 3. We would then have l=n/(k+1)=n/4:
  • There are at most k mismatches in n, so at the very least there must be one out of the k+1 l–tuples without a mismatch








k+ 1

filtration match verification
Filtration: Match Verification
  • For each l -match we find, try to extend the match further to see if it is substantial

Extend perfect match of lengthl

until we find an approximate match of length n with k mismatches



filtration example
Filtration: Example

Shorter perfectmatches required

Performance decreases

local alignment is to slow
Local alignment is to slow…
  • Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database)
local alignment is to slow67
Local alignment is to slow…
  • Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database)
local alignment is to slow68
Local alignment is to slow…
  • Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database)
local alignment is to slow69
Local alignment is to slow…
  • Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database)
  • Guaranteed to find the optimal local alignment
  • Sets the standard for sensitivity
local alignment is to slow70
Local alignment is to slow…
  • Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database)
  • Basic Local Alignment Search Tool
    • Altschul, S., Gish, W., Miller, W., Myers, E. & Lipman, D.J.

Journal of Mol. Biol., 1990

  • Search sequence databases for local alignments to a query
  • Great improvement in speed, with a modest decrease in sensitivity
  • Minimizes search space instead of exploring entire search space between two sequences
  • Finds short exact matches (“seeds”), only explores locally around these “hits”
what similarity reveals
What Similarity Reveals
  • BLASTing a new gene
    • Evolutionary relationship
    • Similarity between protein function
  • BLASTing a genome
    • Potential genes
blast algorithm
BLAST algorithm
  • Keyword search of all words of length w from the query of length n in database of length m with score above threshold
    • w = 11 for DNA queries, w =3 for proteins
  • Local alignment extension for each found keyword
    • Extend result until longest match above threshold is achieved
  • Running time O(nm)
blast algorithm cont d
BLAST algorithm (cont’d)



GVK 18

GAK 16

GIK 16

GGK 14

GLK 13

GNK 12

GRK 11

GEK 11

GDK 11




score threshold

(T = 13)



+++DN +G + IR L G+K I+ L+ E+ RG++K


High-scoring Pair (HSP)

original blast
Original BLAST
  • Dictionary
    • All words of length w
  • Alignment
    • Ungapped extensions until score falls below some statistical threshold
  • Output
    • All local alignments with score > threshold
original blast example
Original BLAST: Example


  • w = 4
  • Exact keyword match of GGTC
  • Extend diagonals with mismatches until score is under 50%
  • Output result


From lectures by Serafim Batzoglou (Stanford)

gapped blast example
Gapped BLAST : Example


  • Original BLAST exact keyword search, THEN:
  • Extend with gaps around ends of exact matchuntil score < threshold
  • Output result




From lectures by Serafim Batzoglou (Stanford)

incarnations of blast
Incarnations of BLAST
  • blastn: Nucleotide-nucleotide
  • blastp: Protein-protein
  • blastx: Translated query vs. protein database
  • tblastn: Protein query vs. translated database
  • tblastx: Translated query vs. translated

database (6 frames each)

incarnations of blast cont d
Incarnations of BLAST (cont’d)
    • Find members of a protein family or build a custom position-specific score matrix
  • Megablast:
    • Search longer sequences with fewer differences
  • WU-BLAST: (Wash U BLAST)
    • Optimized, added features
assessing sequence similarity
Assessing sequence similarity
  • Need to know how strong an alignment can be expected from chance alone
  • “Chance” relates to comparison of sequences that are generated randomly based upon a certain sequence model
  • Sequence models may take into account:
    • G+C content
    • Poly-A tails
    • “Junk” DNA
    • Codon bias
    • Etc.
blast segment score
BLAST: Segment Score
  • BLAST uses scoring matrices (d) to improve on efficiency of match detection
    • Some proteins may have very different amino acid sequences, but are still similar
  • For any two l-mers x1…xl and y1…yl :
    • Segment pair: pair of l-mers, one from each sequence
    • Segment score: Sli=1d(xi, yi)
blast locally maximal segment pairs
BLAST: Locally Maximal Segment Pairs
  • A segment pair is maximal if it has the best score over all segment pairs
  • A segment pair is locally maximal if its score can’t be improved by extending or shortening
  • Statistically significant locally maximal segment pairs are of biological interest
  • BLAST finds all locally maximal segment pairs with scores above some threshold
    • A significantly high threshold will filter out some statistically insignificant matches
blast statistics
BLAST: Statistics
  • Threshold: Altschul-Dembo-Karlin statistics
    • Identifies smallest segment score that is unlikely to happen by chance
  • # matches above q has mean E(q) = Kmne-lq; K is a constant, m and n are the lengths of the two compared sequences
    • Parameter l is positive root of:

Sx,y in A(pxpyed(x,y)) = 1, where px and py are frequenceies of amino acids x and y, and A is the twenty letter amino acid alphabet

p values
  • The probability of finding b HSPs with a score ≥S is given by:
    • (e-EEb)/b!
  • For b = 0, that chance is:
    • e-E
  • Thus the probability of finding at least one HSP with a score ≥S is:
    • P = 1 – e-E
sample blast output
Sample BLAST output
  • Blast of human beta globin protein against zebra fish

Score E

Sequences producing significant alignments: (bits) Value

gi|18858329|ref|NP_571095.1| ba1 globin [Danio rerio] >gi|147757... 171 3e-44

gi|18858331|ref|NP_571096.1| ba2 globin; SI:dZ118J2.3 [Danio rer... 170 7e-44

gi|37606100|emb|CAE48992.1| SI:bY187G17.6 (novel beta globin) [D... 170 7e-44

gi|31419195|gb|AAH53176.1| Ba1 protein [Danio rerio] 168 3e-43


>gi|18858329|ref|NP_571095.1| ba1 globin [Danio rerio]

Length = 148

Score = 171 bits (434), Expect = 3e-44

Identities = 76/148 (51%), Positives = 106/148 (71%), Gaps = 1/148 (0%)








+ F VQ A+QK +A V +AL +YH


sample blast output cont d
Sample BLAST output (cont’d)
  • Blast of human beta globin DNA against human DNA

Score E

Sequences producing significant alignments: (bits) Value

gi|19849266|gb|AF487523.1| Homo sapiens gamma A hemoglobin (HBG1... 289 1e-75

gi|183868|gb|M11427.1|HUMHBG3E Human gamma-globin mRNA, 3' end 289 1e-75

gi|44887617|gb|AY534688.1| Homo sapiens A-gamma globin (HBG1) ge... 280 1e-72

gi|31726|emb|V00512.1|HSGGL1 Human messenger RNA for gamma-globin 260 1e-66

gi|38683401|ref|NR_001589.1| Homo sapiens hemoglobin, beta pseud... 151 7e-34

gi|18462073|gb|AF339400.1| Homo sapiens haplotype PB26 beta-glob... 149 3e-33


>gi|28380636|ref|NG_000007.3| Homo sapiens beta globin region (HBB@) on chromosome 11

Length = 81706

Score = 149 bits (75), Expect = 3e-33

Identities = 183/219 (83%)

Strand = Plus / Plus

Query: 267 ttgggagatgccacaaagcacctggatgatctcaagggcacctttgcccagctgagtgaa 326

|| ||| | || | || | |||||| ||||| ||||||||||| ||||||||

Sbjct: 54409 ttcggaaaagctgttatgctcacggatgacctcaaaggcacctttgctacactgagtgac 54468

Query: 327 ctgcactgtgacaagctgcatgtggatcctgagaacttc 365

||||||||| |||||||||| ||||| ||||||||||||

Sbjct: 54469 ctgcactgtaacaagctgcacgtggaccctgagaacttc 54507

  • 1970: Needleman-Wunsch global alignment algorithm
  • 1981: Smith-Waterman local alignment algorithm
  • 1985: FASTA
  • 1990: BLAST (basic local alignment search tool)
  • 2000s: BLAST has become too slow in “genome vs. genome” comparisons - new faster algorithms evolve!
    • Pattern Hunter
    • BLAT
patternhunter faster and even more sensitive
BLAST: matches short consecutive sequences (consecutive seed)

Length = k

Example (k = 11):


Each 1 represents a “match”

PatternHunter: matches short non-consecutive sequences (spaced seed)

Increases sensitivity by locating homologies that would otherwise be missed

Example (a spaced seed of length 18 w/ 11 “matches”):


Each 0 represents a “don’t care”, so there can be a match or a mismatch

PatternHunter: faster and even more sensitive
spaced seeds
Example of a hit using a spaced seed:Spaced seeds

How does this result in better sensitivity?

why is ph better
Why is PH better?
  • BLAST: redundant hits
  • PatternHunter

This results in > 1 hit and creates clusters of redundant hits

This results in very few redundant hits

why is ph better91
Why is PH better?

BLAST may also miss a hit


|| ||||||||| |||||| | |||||| ||||||


9 matches

In this example, despite a clear homology, there is no sequence of continuous matches longer than length 9. BLAST uses a length 11 and because of this, BLAST does not recognize this as a hit!

Resolving this would require reducing the seed length to 9, which would have a damaging effect on speed

advantage of gapped seeds
Advantage of Gapped Seeds

11 positions

11 positions

10 positions

why is ph better93
Why is PH better?
  • Higher hit probability
  • Lower expected number of random hits
use of multiple seeds
Use of Multiple Seeds

Basic Searching Algorithm

  • Select a group of spaced seed models
  • For each hit of each model, conduct extension to find a homology.
another method blat
Another method: BLAT
  • BLAT (BLAST-Like Alignment Tool)
  • Same idea as BLAST - locate short sequence hits and extend
blat vs blast differences
BLAT vs. BLAST: Differences
  • BLAT builds an index of the database and scans linearly through the query sequence, whereas BLAST builds an index of the query sequence and then scans linearly through the database
  • Index is stored in RAM which is memory intensive, but results in faster searches
blat fast cdna alignments
BLAT: Fast cDNA Alignments


1. Break cDNA into 500 base chunks.

2. Use an index to find regions in genome similar to each chunk of cDNA.

3. Do a detailed alignment between genomic regions and cDNA chunk.

4. Use dynamic programming to stitch together detailed alignments of chunks into detailed alignment of whole.

blat indexing
BLAT: Indexing
  • An index is built that contains the positions of each k-mer in the genome
  • Each k-mer in the query sequence is compared to each k-mer in the index
  • A list of ‘hits’ is generated - positions in cDNA and in genome that match for k bases
indexing an example
Indexing: An Example

Here is an example with k = 3:


3-mers (non-overlapping): cac aat tat cac gac cgc

Index: aat 3 gac 12

cac 0,9 tat 6

cgc 15

cDNA (query sequence): aattctcac

3-mers (overlapping): aat att ttc tct ctc tca cac

0 1 2 3 4 5 6

Hits: aat 0,3

cac 6,0

cac 6,9

clump: cacAATtatCACgaccgc

Multiple instances map to single index

Position of 3-mer in query, genome

  • BLAT was designed to find sequences of 95% and greater similarity of length >40; may miss more divergent or shorter sequence alignments
patternhunter and blat vs blast
PatternHunter and BLAT vs. BLAST
  • PatternHunter is 5-100 times faster than Blastn, depending on data size, at the same sensitivity
  • BLAT is several times faster than BLAST, but best results are limited to closely related sequences
  • 2004/papers/pathunter_grp_prsnt.ppt