Structure, Replication and Recombination of DNA

1. Structure, Replication and Recombination of DNA

2. replication transcription RNA translation Protein Information Flow From DNA DNA

3. DNA Structure

4. DNA Structure Nucleotide = building block of DNA Three components of a nucleotide 1. Nitrogen-containing base purine or pyrimidine 2. 5-carbon sugar 3. Phosphate group

5. DNA Structure

6. P---OH + OH---C  P---O---C + H2O

8. Chemical Bonding

9. Hydrogen bonds hold pairs of bases together.

10. 3’ 5’ 3’ 5’

11. DNA Secondary Structure: The Double Helix • Two polynucleotide chains are wound together • Bases are located inside the helix • Sugar-phosphate groups are on the outside as a “backbone” • Bases are arranged like rungs on a ladder, perpendicular to the “backbone”

12. DNA Secondary Structure: The Double Helix • Hydrogen bonding between bases holds the chains together: A pairs with T G pairs with C • Polynucleotide chains have opposite polarity One is 5’  3’ other is 3’  5’ • 10 base pairs per turn of the helix

13. Applying Your Knowledge In the DNA double helix, which base is paired with adenine? • Adenine • Cytosine • Guanine • Thymine • Uracil

14. DNA Replication: An Overview

15. AGCTAGCTAGCT  AGCTAGCTAGCT old TCGATCGATCGA  TCGATCGATCGAold DNA Replication DNA replication is semiconservative. Each strand is used as a template to produce a new strand. AGCTAGCTAGCTTCGATCGATCGA TCGATCGATCGAnew AGCTAGCTAGCTnew

16. DNA Replication DNA replication requires 1. DNA polymerase, an enzyme that adds nucleotides in a 5’3’ direction. 2. Nucleoside triphosphates 3. Energy: release of diphosphate 5’—A G C T — 3’ 3’— T C G A —5’ 5’— A G C T— 3’ 3’—T C G A—5’

17. origin of replication replication fork replication fork Origin of Replication DNA replication begins at a replication origin and proceeds bidirectionally, creating two replication forks for each origin. Eukaryotic chromosomes have multiple origins of replication.

18. 5’ Okasaki Fragments Lagging strand Discontinuous 3’ Leading strand Continuous 5’ movement of fork 3’ Continuous and Discontinuous Synthesis DNA Polymerase builds a new strand in a 5’3’ direction. This leads to continuous synthesis on the strand oriented 3’5’ and discontinuous on the strand oriented 5’3’.

19. Applying Your Knowledge Discontinuous synthesis occurs on the DNA template oriented • 3’5’ • 5’3’ • Either 3’5’ or 5’3’ • Both 3’5’ and 5’3’ • Neither 3’5’ or 5’3’

20. Steps in DNA Replication (Bacterial) • Initiation Initiator Proteins bind to replication origin and cause a small section to unwind.

21. Steps in DNA Replication (Bacterial) • Unwinding Helicase molecules further unwind helix. Single-stranded binding proteins keep helix from reforming.DNA gyrase reduces supercoils ahead of replication fork.

22. Steps in DNA Replication (Bacterial) • Elongation Primase synthesizes a short RNA strand = primer. DNA polymerase III adds nucleotides to the primer in a 5’3’ direction.

23. Steps in DNA Replication (Bacterial) • Elongation A single primer is required for leading strand replication. On the lagging strand, a new primer is used at the start of each Okasaki fragment.

24. Steps in DNA Replication (Bacterial) • Elongation DNA polymerase I replaces primer RNA with DNA nucleotides. DNA ligase seals gaps in sugar-phosphate backbone.

25. Steps in DNA Replication (Bacterial) • Termination Termination occurs when two replication forks meet. E. coli cells have a protein called Tus that binds to termination sequences and blocks helicase movement.

26. Accuracy of DNA Replication • Nucleotide Selection • DNA proofreading: 3’5’ exonuclease activity of DNA polymerase • Mismatch Repair: repair enzymes

27. Modes of Replication

28. Differences for Eukaryotic DNA Replication • Replication Licensing Factor attaches to each origin, initiator protein only recognizes “licensed” origins • Multiple polymerases function in replication, recombination, repair • Alpha: synthesizes primer and a short stretch of DNA • Delta: continues replication on the lagging strand • Epsilon: continues replication on the leading strand • Topoisomerase enzymes relax supercoils

29. Applying Your Knowledge A new DNA strand is synthesized • From 3’5’ • From 5’3’ • Either from 3’5’ or 5’3’ • Both from 3’5’ and 5’3’ • Neither from 3’5’ or 5’3’

30. Applying Your Knowledge Which enzyme produces a short stretch of RNA nucleotides used as a starting point for DNA synthesis? • Helicase • DNA polymerase I • Single strand binding protein • DNA polymerase III • Primase

31. Applying Your Knowledge Which enzyme can remove an incorrectly-inserted nucleotide? • Helicase • DNA Gyrase • Single strand binding protein • DNA polymerase • Primase

32. Replication at the Ends of Linear Chromosomes • Removal of the primer at the end of a linear chromosome leaves a gap • Linear chromosomes tend to shorten at the telomeres over repeated cycles of replication

33. Telomerase Extends the Telomere’s 3’ End • Telomerase is an enzyme composed of both protein and RNA • RNA portion binds to the overhanging 3’ end of the telomere, providing a template for elongation • Mechanism for replicating the complementary strand is uncertain

34. Recombination

35. Holliday Model of Recombination • Single strand breaks occur at the same position on homologous DNA helices. • Single-stranded ends migrate into the alternate helix.

36. Holliday Model of Recombination • Each migrating strand joins to the existing strand, creating a Holliday junction. • Branch point can migrate, increasing the amount of heteroduplex DNA.

37. Holliday Model of RecombinationResolving the Holliday Intermediate • Separation of the duplexes requires cleavage in either the horizontal or vertical plane.

38. Holliday Model of RecombinationResolving the Holliday Intermediate • Cleavage in the vertical plane, followed by rejoining of nucleotide strands, produces crossover recombinant products.

39. Gene Conversion Occurs with Repair of Heteroduplex DNA

40. Gene Conversion Occurs with Repair of Heteroduplex DNA Gene Conversion can lead to abnormal genetic ratios.