amable
Uploaded by
15 SLIDES
912 VIEWS
250LIKES

The Gateway® Cloning System

DESCRIPTION

Cloning multiple fragments into a single vector. The Gateway® Cloning System. Contents. How to clone up to 4 DNA fragments simultaneously into one destination vector. Examples of expression of multiple genes in HeLa cells.

1 / 15

Download Presentation

The Gateway® Cloning System

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Cloning multiple fragments into a single vector The Gateway® Cloning System Contents How to clone up to 4 DNA fragments simultaneously into one destination vector. Examples of expression of multiple genes in HeLa cells. Example of testing the effects of promoters and regulatory elements on protein expression.

  2. Your Source PCR Library ORF Gene collection synthesis Gene Gene Gene Protein Your Application Localization Gene Entry Clone Gene Gene Protein RNAi Purification Gene Gene Protein Cell-Free interaction Gene1 Gene2 Gene3 Gene4 Your Application MultiSite Gateway® - Extending the applications Invitrogen Proprietary & Confidential

  3. Sample Applications • Optimized multigene delivery without co-transfection • Expression of enzymatic pathways • Expression of multi-subunit protein complexes • Gene knock-down and rescue (controllable RNAi and heterologous gene expression from the same construct) • Variable gene expression levels using different expression elements • Combinatorial tagging Invitrogen Proprietary & Confidential

  4. More att sequences needed CTGCTTTTTTGTACAAACTTG attB1 CAGCTTTCTTGTACAAAGTTG attB2 CAACTTTATTATACAAAGTTG attB3 CAACTTTTCTATACAAAGTTG attB4 CAACTTTTGTATACAAAGTTG attB5 Standard Gateway® MultiSite Gateway® Invitrogen Proprietary & Confidential

  5. 2-fragment MultiSite Gateway® Pro PCR Fragments attB1 attB5r attB5 attB2 X X X X pDONRs attP1 attP5r attP5 attP2 BP reactions attL5 attL2 Entry Clones X attL1 attR5 X Destination Vectors attR1 attR2 LR reaction Expression clones attB1 attB5 attB2 Invitrogen Proprietary & Confidential

  6. 3-fragment MultiSite Gateway® Pro PCR Fragments attB1 attB4 attB4r attB3r attB3 attB2 X X X X X X pDONRs attP1 attP4 attP4r attP3r attP3 attP2 BP reactions attL1 attL4 attL3 attL2 Entry clones X X attR4 attR3 Destination vector CmR ccdB attR1 attR2 LR reaction Expression clone attB1 attB4 attB3 attB2 Invitrogen Proprietary & Confidential

  7. 4-fragment MultiSite Gateway® Pro PCR Fragments attB1 attB5r attB5 attB4 attB4r attB3r attB3 attB2 X X X X X X X X pDONRs attP1 attP5r attP5 attP4 attP4r attP3r attP3 attP2 BP reactions attL5 attL4 attL3 attL2 Entry Clones X X X attL1 attR5 attR4 attR3 X Destination Vectors attR1 attR2 LR reaction Expression clones attB1 attB5 attB4 attB3 attB2 Invitrogen Proprietary & Confidential

  8. PCR Fragments attB4 attB1r attB1 attB2 attB2r attB3 X X X X X X attP4 attP1r attP1 attP2 attP2r attP3 pDONRs Expression clone attB4 attB1 attB2 attB3 MultiSite Gateway® Three-Fragment Vector Construction Kit BP reactions attL4 attR1 attR2 attL3 Entry clones X X attL1 attL2 Destination vector CmR ccdB attR4 attR3 LR reaction Invitrogen Proprietary & Confidential

  9. 2 10 - 10 80 - 100 3 5 Typical Results Number of Expected # colonies per Typical recombination recombining 10 L reaction ef ficiency (%) fragments 1 10 - 10 90 - 100 3 6 3 10 - 10 70 - 90 3 4 4 10 - 10 30 - 80 2 3 Invitrogen Proprietary & Confidential

  10. In silico cloning using Vector NTI AdvanceTM 10.3 DNA of interest Primers for PCR reaction Cloning Strategy Invitrogen Proprietary & Confidential

  11. PCAG EGFP mRFP EGFP mRFP EGFP mRFP Shortcomings when co-transfecting two plasmids Plasmid 1 Plasmid 2 Courtesy of Dr. Imamoto, Osaka University, Japan Invitrogen Proprietary & Confidential

  12. Example: Expression of Multiple Genes in Human Cells CFP YFP A a pCMV pEF1 B3 CFP B2 B1 YFP B4 a pCMV pEF1 B3 CFP B2 B1 B5 YFP B4 B Invitrogen Proprietary & Confidential

  13. Rapid Testing of Expression Elements using MultiSite Gateway® Kozak or IRES Promoter EGFP pABGH HeLa Kozak or Gtx Determination of expression level of EGFP aurora A 2xGtx cdc 2 5xGtx cyclin B1 12xGtx EMCV cyclin E IRES ( Internal Ribosome Entry Site ) mHCV2a CMV mHCV33 EF1-a mHCV45 ( CAG ) HCV2a ( SV40 ) HCV33 HCV45 Courtesy of Dr. Imamoto, Osaka University, Japan Invitrogen Proprietary & Confidential

  14. Rapid Testing of Expression Elements using MultiSite Gateway® 40.0 29 35.0 30.0 25.0 20.0 13 13 9 15.0 7 7 4 10.0 1 1 5.0 0.0 Gtx None 2xGtx 5xGtx Kozak 12xGtx EMCV mHCV45 mHCV33 mHCV2a Kozak or Promoter IRES EGFP pA HeLa Transcriptional signals with Kozak Translational signals with CMV promoter 350 300 250 Relative activity 200 150 100 50 0 CMV cdc 2 EF1-a cyclin E cyclin B1 aurora A Courtesy of Dr. Imamoto, Osaka University, Japan Invitrogen Proprietary & Confidential

  15. Summary for MultiSite Gateway® Technology Invitrogen Proprietary & Confidential

More Related