Trees
160 likes | 268 Views
This review by Chris North explores advanced methods for visualizing multi-dimensional data using hierarchical tree structures. Key strategies such as dynamic queries, multiple views, and interaction techniques like brushing and linking are discussed to enhance user engagement and data comprehension. The text delves into the complexity of tree visualization, examining the challenges posed by data size and structural representation. Empirical evaluations and design guidelines offer insights into optimizing visual overviews, zooming, and context-focused exploration for tasks related to triangulating patterns in extensive datasets. ###
Trees
E N D
Presentation Transcript
Trees cs5984: Information Visualization Chris North
Review • Data space: • Multi-dimensional • 1-D space • 2-D space • Interaction strategies: • Dynamic Queries • Multiple views, brushing & linking • Visual overviews • Zooming, overview+detail, focus+context • Design guidelines • Empirical Evaluation
Next • Data space: • 3-D • Trees • Networks • Document collections • Workspaces • Theory • …
Trees (Hierarchies) • What is a tree? • Items + structure • Add parent pointer attribute • Examples • Family trees, Directories, Org charts, biology taxonomy, menus • Tasks • All previous tasks plus structure-based tasks: • Find descendants, ancestors, siblings, cousins • Overall structure, height, breadth, dense/sparse areas
Tree Visualization • Example: Outliner • Why is tree visualization hard? • Structure AND items • Structure harder, consumes more space • Data size grows very quickly (exponential) • #nodes = bheight
2 Approaches • Connection (node & link) • Containment (node in node) • Structure vs. attributes • Attributes only (multi-dimensional viz) • Structure only (1 attribute, e.g. name) • Structure + attributes A B C A B C
Outliner • Good for directed search tasks • Not good for learning structure • No attributes • Apx 50 items visible • Lose path to root for deep nodes
Mac Finder Branching factor: Small large
Today • Rao, “Hyperbolic Tree”, book pg 382 • Joy, maulik
Nifty site of the day: X-Files • http://www.thexfiles.com/main_flash.html
ConeTree / CamTree • Video CHI’91
WebTOC • Website map: Outliner + size attributes • http://www.cs.umd.edu/projects/hcil/webtoc/fhcil.html
PDQ Trees • Overview+Detail of 2D layout • Dynamic Queries on each level for pruning
Assignment • Read for Thurs • Johnson, “Treemaps”, book pg 152 • Stasko, “Sunburst”, web • Marcus, marty • Homework #2 due Thurs • Spring Break! • Read for Tues (Mar 13) • Beaudoin, “Cheops”, web • Satya, sumithra • Furnas, “Fisheye View”, book pg 311
Scenario: Visualizing Biotech Data • Database of experiments on DNA • 1000 experiments? • DNA = long sequence of letters A,C,T,G • 100,000 – 1,000,000 letters • Experiment = data values for set of sub-sequences • 1000 sub-sequences, 10-100 letters / sub-sequence • Tasks: • Find experiments given criteria • Find patterns between known set of experiments • Find related experiments • Find trends in experimentation DNA: AAGTGTTCCGAAATGCAAAAATAGACCCAAAGA… Experiment: (5-50)=1.4, (72-112)=0.2, …