630 likes | 778 Views
Marcatori genetici nel plant breeding. Utilizzo. Identificazione clonale. Analisi dei parentali. Struttura familiare. SCALA. Struttura di popolazione. Flusso genico. Filogeografia. Ibridizzazione. Filogenesi. Marcatori in biologia.
E N D
Utilizzo • Identificazione clonale • Analisi dei parentali • Struttura familiare SCALA • Struttura di popolazione • Flusso genico • Filogeografia • Ibridizzazione • Filogenesi
Marcatori in biologia Marcatori fenotipici = caratteri distinguibili a occhio nudo Colore del fiore, forma del baccello, etc.. • P = E+G
Molecular markers Sequenze di proteine o DNA facilmentedistinguibili, la cui eredità può essere verificata e associata con tratti ereditati indipendentemente dall’ambiente : a) Polimorfismi di proteine b) Polimorfismi di DNA
Molecularmarkers • Sequenze(SNPs) • Microsatelliti (SSRs) • Multi-locus fingerprints • AFLP(Amplified Fragment Length Polymorphism) Potere di risoluzione • RAPD(random amplified polymorphic DNA) • DNA cloroplastico PCR-RFLP • allozimi (elettroforesi di proteine)
Polimorfismi di proteine Proteine di riserva del seme Isozimi
Isozimi Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus).
Stretch of nitrogen fixation gene in soybean 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ………. Struttura del DNA dal cromosoma al DNA
1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag DNA M1 M2 Gene A Gene B MFG MFG AAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAA molecular marker? readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance
Image from UV light table Image from computer screen
Gel configuration P 1 P 2 O 1 O 2 Gel configuration P 1 P 2 O 2 O 1 Co-dominant marker Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 Dominant marker Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ????
Dominant versus Co-dominant Dominant: No distinction between homo- and heterozygotes possible No allele frequencies available AFLP, RAPD Co-dominant: homozygotes can be distinguished from heterozygotes; allele frequencies can be calculated microsatellites, SNP, RFLPs
Desirable properties for a good molecular marker * Polymorphic * Co-dominant inheritance * Occurs throughout the genome * Reproducible * Easy, fast and cheap to detect * Selectivity neutral * High resolution with large number of samples
Basis for DNA marker technology • Restriction Endonucleases • Polymerase chain reaction (PCR) • DNA-DNA hybridization • DNA sequencing
RFLP based markers *Examine differences in size of specific DNA restriction fragments *Require pure, high molecular weight DNA *Usually performed on total cellular genome
YFG AAATCGGGACCTAATGGGCC ATTTAGGGCAATTCCAAGGA Ind 1 Ind 2 Endonucleases and restriction sequences
1 2 3 4 5 MFG 1 2 3 4 5 6 RFLP Polymorphisms interpretation 6
Advantages and disadvantages of RFLP • Disadvantages • Time consuming • Expensive • Use of radioactive probes • Advantages • Reproducible • Co-dominant • Simple
Denaturation Elevated temperature Known DNA sequence DNA/DNA Hybridization
Polymerase Chain Reaction • Powerful technique for amplifying DNA • Amplified DNA are then separated by gel electrophoresis
PCR based methods • *Four nucleotides (dATP, dCTP, dGTP, dTTP) 1. Reactions conditions • *Target DNA ( or template) *Reaction buffer containing the co-factor MgCl2 • *One or more primers • *Thermostable DNA polymerase
2. Use of DNA polymerase • = an enzyme that can synthesize DNA at • elevated temperature • ex : Taq = enzyme purified from hot spring bacterium : Thermus aquaticus 3. Thermal cycle • *Denaturing step - one to several min at 94-96 º C • *Annealing step - one to several min at 50-65 º C • *Elongation step - one to several min at 72 º C 4. Repetition • typically 20 to 50 times average 35 times
AFLP Markers • Most complex of marker technologies • Involves cleavage of DNA with two different enzymes • Involves ligation of specific linker pairs to the digested DNA • Subsets of the DNA are then amplified by PCR
AFLP Markers • The PCR products are then separated on acrylamide gel • 128 linker combinations are readily available • Therefore 128 subsets can be amplified • Patented technology
AFLP Markers • Technically demanding • Reliable and stable • Moderate cost • Need to use different kits adapted to the size of the genome being analyzed. • Like RAPD markers need to be converted to quick and easy PCR based marker
RAPD Markers • There are other problems with RAPD markers associated with reliability • Because small changes in any variable can change the result, they are unstable as markers • RAPD markers need to be converted to stable PCR markers. • How?
RAPD Markers • The polymorphic RAPD marker band is isolated from the gel • It is used a template and re-PCRed • The new PCR product is cloned and sequenced • Once the sequence is determined, new longer and specific primers can be designed
RAPD • Amplifies anonymous stretches of DNA using arbitrary primers • Fast and easy method for detecting polymorphisms • Domimant markers • Reproducibility problems
Name Sequence OP A08 5’ –GTGACGTAGG- 3’ OP A15 5’ –TTCCGAACCC- 3’ OP A 17 5’ –GACCGCTTGT- 3’ OP A19 5’ –CAAACGTCGG- 3’ OP D02 5’ –GGACCCAACC- 3’ Sequences of 10-mer RAPD primers RAPD gel configuration RAPD Polymorphisms among landraces of sorghum M
Repeat Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA….. GGT(5) SSR repeats and primers GAGGGCTGATGAGGTGGATA ATCTTATGGCGGTTCTCGTG
AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2 P1 P2 SSR polymorphisms Gel configuration
N97 Anand SSR scoring for F 5:6 pop from the cross Anand x N97-3708-13 M
SNPs on a DNA strand Hybridization using fluorescent dyes 4. SNPs (Single Nucleotide Polymorphisms) • Any two unrelated individuals differ by one base pair every • 1,000or so, referred to as SNPs. • Many SNPs have no effect on cell function and therefore • can be used as molecular markers.
Sequencer Sequencing gel Sequencing graph DNA sequencing
MFG MFG Types of traits =types of markers Single gene trait: seed shape Multigenic trait; ex: plant growth =Quantitative Trait Loci
USES OF MOLECULAR MARKER • Measure genetic diversity • Mapping • Tagging
Genetic Diversity • Define appropriate geographical scales for monitoring and management (epidemology) • Establish gene flow mechanism • identify the origin of individual (mutation detection) • Monitor the effect of management practices • manage small number of individual in ex situ collection • Establish of identity in cultivar and clones (fingerprint) • paternity analysis and forensic
Gotcha! fingerprints seeds, plantlets early selection of the good allele
Mapping • The determination of the position and relative distances of gene on chromosome by means of their linkage • Genetic map A linear arrangement of genes or genetic markers obtained based on recombination • Physical map A linear order of genes or DNA fragments
Physical Mapping • It contains ordered overlapping cloned DNA fragment • The cloned DNA fragments are usually obtained using restriction enzyme digestion
QTL Mapping • A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics effects and location To assist selection
Marker Assisted Selection • Breeding for specific traits in plants and animals is expensive and time consuming • The progeny often need to reach maturity before a determination of the success of the cross can be made • The greater the complexity of the trait, the more time and effort needed to achieve a desirable result.