slide1
Download
Skip this Video
Download Presentation
Roger Kaspar TransDerm [email protected]

Loading in 2 Seconds...

play fullscreen
1 / 41

Roger Kaspar TransDerm [email protected] - PowerPoint PPT Presentation


  • 91 Views
  • Uploaded on

Dundee Patient Support Meeting On the road to the clinic: Development of siRNA-based therapeutics for PC. Roger Kaspar TransDerm [email protected] PC is what we call a dominant negative genetic disorder. Translation. Bad keratin. Good keratin. Translation.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Roger Kaspar TransDerm [email protected]' - ailani


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Dundee Patient Support MeetingOn the road to the clinic:Development of siRNA-based therapeutics for PC

Roger Kaspar

TransDerm

[email protected]

slide5
1 gene comes from each parent

50% chance of passing it along to kids

multiple strategies to developing a pc therapeutic1

Multiple strategies to developing a PC therapeutic

  • Block the bad gene from being made
multiple strategies to developing a pc therapeutic2

Multiple strategies to developing a PC therapeutic

  • Block the bad gene from being made
  • Block the bad gene’s effects
multiple strategies to developing a pc therapeutic3

Multiple strategies to developing a PC therapeutic

  • Block the bad gene from being made
  • Block the bad gene’s effects
  • Block both the bad and good genes
multiple strategies to developing a pc therapeutic4

Multiple strategies to developing a PC therapeutic

  • Block the bad gene from being made
  • Block the bad gene’s effects
  • Block both the bad and good genes
  • Increase the amount of the good gene to try and swamp out the effects of the bad
multiple strategies to developing a pc therapeutic5

Multiple strategies to developing a PC therapeutic

  • Block the bad gene from being made
  • Block the bad gene’s effects
  • Block both the bad and good genes
  • Increase the amount of the good gene to try and swamp out the effects of the bad
multiple strategies to developing a pc therapeutic6

Multiple strategies to developing a PC therapeutic

  • Block the bad gene from being made
  • Block the bad gene’s effects
  • Block both the bad and good genes
  • Increase the amount of the good gene to try and swamp out the effects of the bad
slide13
Transfected cells stained with DAPI

and visualized by fluorescence microscopy

K6a-wt/YFP

K6a-N171K mut/YFP

slide16
Screening for effective N171K siRNA inhibitors

K6A WT GTGAACAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTC

K6A N171K GTGAACAGATCAAGACCCTCAAAAACAAGTTTGCCTCCTTC

Inhibitors:

K6a_513.1 ACAGAUCAAGACCCUCAAaUU

K6a_513.2 CAGAUCAAGACCCUCAAaAUU

K6a_513.3 AGAUCAAGACCCUCAAaAAUU

K6a_513.4 GAUCAAGACCCUCAAaAACUU

K6a_513.5 AUCAAGACCCUCAAaAACAUU

K6a_513.6 UCAAGACCCUCAAaAACAAUU

K6a_513.7 CAAGACCCUCAAaAACAAGUU

K6a_513.8 AAGACCCUCAAaAACAAGUUU

K6a_513.9 AGACCCUCAAaAACAAGUUUU K6a_513.10 GACCCUCAAaAACAAGUUUUU K6a_513.11 ACCCUCAAaAACAAGUUUGUU

K6a_513.12 CCCUCAAaAACAAGUUUGCUU

K6a_513.13 CCUCAAaAACAAGUUUGCCUU

K6a_513.14 CUCAAaAACAAGUUUGCCUUU

K6a_513.15 UCAAaAACAAGUUUGCCUCUU

K6a_513.16 CAAaAACAAGUUUGCCUCCUU

K6a_513.17 AAaAACAAGUUUGCCUCCUUU

K6a_513.18 AaAACAAGUUUGCCUCCUUUU

K6a_513.19 aAACAAGUUUGCCUCCUUCUU

slide18
K6a(N171K) siRNA #4

K6a(N171K) siRNA #12

Filaments

Mixture

Aggregates

WT plasmid

N171K plasmid

WT + N171K

Tissue culture model of dominant

negative genetic disorder

(K6a wt + K6a N171K expression plasmids + indicated siRNA)

Control siRNA

slide24
K6a-wt/Tomato

+ K6a-mut/YFP

+ NSC4 siRNA

slide38
It’s great to have potent inhibitors, but . . .

How do we deliver them to the cells that need them?

slide39
Transgenic L2G mouse model

Keratinocytes express Green Fluorescent Protein (eGFP)

Skin GFP Transgenic Lines

Fluorescence (Green Pseudocolor)

6.4x109 2.4x109 0.4x109

Tg Newborn Skin

Tg Adult Skin

Balb C Control

200x

400x

200x

Yuan Cao, Stephan Shultz & Andreas Beilhack

can we inhibit gene expression in the skin
Can we inhibit gene expression in the skin?

Day 0

Day 3

Day 6

Day 14

Top paw--Inhibitor of Green Fluorescent Protein (eGFP)

Bottom paw--Non-specfic control inhibitor

slide41
NSC4

3.9 wt* chol

3.9 wt*

N/A

PBS

ad